AAMC SB2 BB [Ext]

 

The passage describes an adult presenting with chronic diarrhea, weight loss despite high food intake, glucosuria (glucose in urine), hyperglycemia, steatorrhea (fat in stool), and undigested meat fibers, which indicate malabsorption. The small intestine biopsy was non-pathological and showed normal bile presence but an abnormally low pH of 4, suggesting acid from the stomach was not neutralized properly. Meanwhile, the pancreatic biopsy revealed inflammation due to Coxsackie B3 virus, and the patient was recommended for pancreatic enzyme supplementation, implying loss of exocrine function. However, elevated fasting and postprandial blood glucose, along with glucose detected in urine, point to a loss of endocrine function, specifically insulin deficiency.
Secretin is secreted by the S cells of the duodenum in response to acidic chyme from the stomach. It stimulates the pancreas to secrete bicarbonate-rich fluid that neutralizes gastric acid in the duodenum.

In this case, the small intestine has a pH of 4, which is abnormally low for the duodenum (normally around 6–7). This suggests that the neutralization of gastric acid is impaired, likely because pancreatic secretion is reduced due to inflammation. The low duodenal pH supports reduced pancreatic responsiveness to secretin or possibly reduced secretin levels, but secretin is produced by the small intestine, not the pancreas. Since the small intestine biopsy was non-pathological, secretin production is likely intact. The issue is more likely the pancreas failing to respond, not reduced secretin levels.

Insulin is produced by beta cells in the islets of Langerhans in the endocrine pancreas.

Insulin lowers blood glucose by promoting cellular glucose uptake and glycogen synthesis, especially after a carbohydrate-rich meal. The normal fasting glucose level should be below 95 mg/dL, and the 2-hour post-glucose value should be below 140 mg/dL. In this individual, the glucose tolerance test showed a fasting level of 135 mg/dL and a 2-hour level of 210 mg/dL, both consistent with impaired insulin secretion. Since the pancreas is inflamed due to CB3 infection, this virus likely damaged insulin-producing cells.

Gastrin is produced by G cells of the stomach in response to food and stimulates acid secretion by parietal cells. The passage does not suggest reduced gastric acid secretion. A low pH in the duodenum indicates that the stomach is producing acid normally. Therefore, there is no evidence that gastrin levels are reduced.
CCK is secreted by the I cells of the duodenum and jejunum in response to fatty acids and amino acids. It stimulates the release of pancreatic enzymes and gallbladder contraction. In this case, bile is present in the intestine (so CCK-induced bile release appears intact), but pancreatic enzymes are lacking, likely due to pancreatic inflammation, not reduced CCK. The small intestine biopsy was non-pathological, suggesting that CCK production is likely unaffected.

To answer this question, we need to focus on the cardiac effects of CB3 infection described in the passage and apply relevant content knowledge about myocardial physiology. The passage states that Coxsackie B3 virus (CB3) can infect the heart. If it does, it can lead to arrhythmia due to dysfunction in depolarization and repolarization of myocardial cells. This phrase directly points to the disruption of electrical activity in the heart muscle, which requires a review of the cellular structures responsible for electrical signaling.

Voltage-Gated Sodium Channels open rapidly during phase 0 of the cardiac action potential, allowing a rapid influx of Na+ ions, which causes depolarization of the cardiac membrane. This is the main upstroke of the action potential in non-pacemaker cells (such as ventricular myocytes).

L-type Voltage-Gated Calcium Channels open during phase 2 (plateau phase), permitting Ca2+ influx, which contributes to the maintenance of depolarization and triggers calcium-induced calcium release from the sarcoplasmic reticulum for contraction.

Voltage-Gated Potassium Channels are responsible for repolarization (phases 1 and 3) by enabling K+ efflux. Mutations or dysfunction in these channels can lead to prolonged or shortened action potentials, predisposing to arrhythmias.

The endothelium is the thin layer of cells lining the blood vessels, including coronary vessels in the heart. The passage does not mention any vascular involvement or symptoms such as ischemia or vessel inflammation. More importantly, endothelial cells do not regulate cardiac depolarization or repolarization. Therefore, this is not supported by the passage.
Dense bodies are found in smooth muscle cells, which anchor actin filaments and play a role in contraction. They are not features of cardiac muscle. Since the heart is composed of striated cardiac muscle, not smooth muscle, dense bodies are irrelevant to myocardial depolarization or repolarization. This choice can be eliminated on anatomical grounds.
This is the best answer based on the passage and content review. The passage explicitly mentions that CB3 can cause arrhythmia by affecting depolarization and repolarization of myocardial cells. These two processes depend on voltage-gated ion channels, including sodium (Na+), potassium (K+), and calcium (Ca2+) channels. Any viral disruption of these ion channels—either by direct viral protein interference, host membrane damage, or alteration of channel expression—could impair cardiac electrical activity and cause arrhythmias.

From a physiological standpoint, depolarization occurs due to the influx of Na+ and Ca2+, while repolarization depends on K+ efflux. Therefore, ion channel dysfunction would logically explain disturbances in both processes.

Microtubules are part of the cytoskeleton, which maintains cell shape and facilitates intracellular transport, especially during mitosis or in the trafficking of vesicles. While viruses can use microtubules for transport during infection, the passage specifically connects CB3 to electrical conduction abnormalities, not structural support or transport. Microtubules are not directly involved in cardiac depolarization or repolarization, so this option is not supported.

To answer this question, we must focus on what the researchers observed in the small intestine biopsy. Then, we need to recall what structures are normally found in the small intestinal mucosa under non-pathological conditions, which is how the biopsy was described.

The passage states, “The biopsy of the small intestine showed a non-pathological structure…” This means the small intestine’s tissue was normal—there were no signs of inflammation, tissue damage, or structural abnormalities. That implies the histology showed normal intestinal mucosal features, which should guide our answer.

Rugae are folds found in the stomach, not the small intestine.

While mucus-secreting goblet cells are present in the intestine, the large number of mucus cells is more characteristic of the large intestine.

So this choice incorrectly describes the wrong part of the GI tract.

Flattened microvilli would be abnormal and suggest a pathological condition like celiac disease or microvilli atrophy, impairing absorption. The small intestine is rich in blood vessels and lymphatic vessels to support nutrient absorption, so “few blood vessels” contradicts normal anatomy.
The normal histological features of the small intestine include: microvilli on the apical surface of enterocytes to increase surface area for absorption, capillary beds within each villus to absorb amino acids, monosaccharides, and water-soluble vitamins, and lacteals, which are lymphatic vessels specialized for the absorption of dietary lipids such as fatty acids and monoglycerides.

These structures are all consistent with normal absorptive function, and the passage clearly states the small intestine biopsy was non-pathological, meaning these features would have been visible.

This answer choice would be consistent with inflammation or infection (e.g., enteritis or autoimmune conditions), which the passage explicitly rules out. A normal small intestine biopsy should not show infiltration of immune cells into the epithelial layer.

The individual described in the passage exhibits symptoms strongly suggesting impaired digestion and absorption. These include weight loss despite consuming large amounts of food, glucose in the urine, osmotic diarrhea, undigested meat fibers, and fat in the stool. Such findings indicate that the patient is experiencing malabsorption due to a deficiency in digestive enzymes, which is confirmed by the biopsy revealing inflammation of the pancreas. Importantly, the pancreas serves an exocrine function by secreting digestive enzymes into the small intestine, and the researchers recommended treatment with supplemental pancreatic enzymes. This detail is central to the question because it tells you that the enzymes being supplemented must perform the functions normally performed by the exocrine pancreas.
The enzymes that the pancreas secretes into the small intestine include proteases, lipases, and amylases. All of these are enzymes that catalyze the hydrolysis of macromolecules, breaking them down into absorbable units.

Proteases such as trypsin and chymotrypsin break down proteins by hydrolyzing peptide bonds. Lipases catalyze the hydrolysis of triglycerides into fatty acids and monoglycerides. Amylase acts on polysaccharides like starch to release simple sugars. These enzymes belong to the same class—hydrolases—enzymes that cleave chemical bonds using water. Because this patient lacks pancreatic enzyme function, the supplementation recommended by researchers would involve replacing these lost hydrolase enzymes. Therefore, the correct answer is hydrolases.

Ligases are enzymes that catalyze the joining of two molecules, usually with the input of ATP. They are important in biosynthetic reactions, such as DNA ligase joining two DNA fragments, but they have no role in the breakdown of food molecules.

Because digestion involves degradation rather than synthesis, ligases are inappropriate for supplementation in this context.

Lyases catalyze breaking bonds without hydrolysis or oxidation, often forming double bonds or cyclic structures. While they are involved in various metabolic pathways, they are not responsible for cleaving proteins, lipids, or carbohydrates during digestion, so they would not be used as pancreatic enzyme replacements.
Oxidoreductases are enzymes that catalyze oxidation-reduction (redox) reactions, involving the transfer of electrons between molecules. These are found in energy metabolism, such as cellular respiration, but they are not digestive enzymes. The presence of glucose and fat in the stool, along with undigested proteins, indicates that the issue is not an energy metabolism defect but a deficiency in enzymes that hydrolyze macronutrients in the digestive tract.

To determine the approximate molecular weight of the polyprotein translated by the Coxsackie B3 virus (CB3), we must apply our knowledge of the relationship between nucleic acid sequence length and protein molecular weight.

The passage states that CB3 is a positive-sense, single-stranded RNA virus with a genome of approximately 7.5 kb (kilobases). CB3’s RNA genome functions directly as messenger RNA (mRNA) like other positive-sense RNA viruses. Host ribosomes translate it into a single large polyprotein cleaved into functional viral proteins. The question asks for the approximate molecular weight of this full-length polyprotein.

We can use a common conversion factor to estimate the molecular weight of a protein from the size of its encoding gene. A coding sequence of 3 base pairs (bp) corresponds to 1 amino acid, and the average molecular weight of an amino acid is approximately 110 daltons (Da).

This answer choice would be the weight if the number of nucleobases were multiplied by 3, instead of being divided by 3. This answer mistakenly assumes that each nucleotide contributes directly to the weight rather than considering the translation process. The incorrect assumption would be 7500 nucleotides × 3 × 110 ≈ 2500 kDa, but in reality, each amino acid is coded by 3 nucleotides, not 1 nucleotide per amino acid.
Coxsackie-B3 (CB3) virus has a genome of 7.5 kilobases (kb), 7500 nucleotides. Since each codon (triplet of nucleotides) codes for one amino acid, we calculate the number of amino acids in the polyprotein as 7500 nucleotides ÷ 3 = 2500 amino acids. Since the average molecular weight of an amino acid is 110 Da (Daltons), the molecular weight of the polyprotein is 2500 amino acids × 110 Da/amino acid = 275,000 Da ≈ 270 kDa.
This answer choice assumes that each nucleotide directly translates to an amino acid instead of every 3 nucleotides coding for 1 amino acid. The incorrect assumption would be 7500 nucleotides × 1 Da = 7.5 kDa, but the polyprotein consists of amino acids, not nucleotides, and each amino acid is much heavier than 1 Da. This would be the molecular weight of the polyprotein if each nucleobase corresponds to an amino acid, and each amino acid weighs 1 D.
This would be the molecular weight if each amino acid weighs 1 Da, which is incorrect. The incorrect assumption would be 2500 amino acids × 1 Da ≈ 2.7 kDa, but an amino acid’s average molecular weight is 110 Da, making the polyprotein weight much higher.

CB3 is described in the passage as a non-enveloped, positive-sense, single-stranded RNA virus that uses cellular autophagy to promote replication.

Autophagy is a cellular degradation and recycling process that helps maintain homeostasis by removing damaged organelles, misfolded proteins, and other unnecessary cellular components. The term “autophagy” means “self-eating.” It describes the cell’s ability to break down its materials in a controlled manner. This process is especially important during nutrient deprivation, stress, or infection.

While autophagy may initially seem like a protective or virus-supportive mechanism, there’s a critical point in understanding viral pathology: many viruses that hijack autophagy also eventually induce host cell death, particularly when viral replication overwhelms the cell. One of the major pathways of virus-induced cell death is apoptosis, which involves the activation of caspases, a family of cysteine proteases that orchestrate the dismantling of cellular components in a regulated manner.

CB3 infection promotes viral replication early on through autophagy, but eventually leads to apoptosis of host cells, which is mediated by caspase activation. This is consistent with known outcomes of CB3 infection in pancreatic and myocardial cells and fits with the passage’s mention of viral replication causing tissue dysfunction. On the MCAT, associating viral infection with host cell death pathways, particularly caspase-mediated apoptosis, is a high-yield concept.
While the passage mentions that CB3 uses autophagy to promote replication, this should not be confused with the idea that the cell is producing new membrane as a primary response. The virus utilizes existing intracellular membranes (e.g., from ER or autophagosomes), and membrane remodeling is secondary to infection. Importantly, this process supports viral replication, but it is not the hallmark process observed in the infected cell. The MCAT will expect you to focus on cellular consequences, such as apoptosis, rather than intermediate replication structures.
This process is not a known response to viral infection. While organelle membranes may be used or damaged during infection, infected cells do not replicate organelles like mitochondria or Golgi in response to CB3 infection.
CB3 is an RNA virus. It does not induce replication of host DNA, which occurs in the nucleus during the S phase of the cell cycle. Therefore, this option is not relevant to CB3 pathogenesis.

To answer this question, we need to identify the correct replication strategy for Coxsackie B3 virus (CB3), based on both the information provided in the passage and knowledge of viral molecular biology.

Viruses are classified based on their genome type. The defining feature of positive-sense single-stranded RNA viruses (+ssRNA viruses) like CB3 is that their RNA genome acts as mRNA. As soon as they enter the host cell cytoplasm, their RNA can be directly translated by host ribosomes into viral proteins, including RNA-dependent RNA polymerase (RdRp). This viral polymerase then synthesizes a complementary negative-sense RNA (-ssRNA) strand, which serves as a template to generate additional copies of the positive-sense RNA genome.

This replication cycle is entirely cytoplasmic, and does not involve DNA, reverse transcription, or integration into the host genome. Therefore, any option that involves conversion to DNA or genome integration can be ruled out.

This option describes the replication strategy of DNA viruses or retroviruses. CB3 is an RNA virus and does not convert its genome into DNA. It uses RNA-dependent RNA polymerase, not DNA-dependent RNA polymerase.
Integration into the host genome is characteristic of retroviruses, such as HIV, which use reverse transcriptase to integrate a DNA copy of their RNA genome into the host genome. CB3 does not integrate into the host DNA.
This choice also describes the retroviral strategy, which involves reverse transcription (RNA → DNA) and integration. CB3 does not carry reverse transcriptase and does not enter the nucleus. Therefore, this mechanism is not applicable.
This option accurately describes the replication strategy of positive-sense single-stranded RNA viruses. After the virus enters the host cell, its +ssRNA is immediately translated into viral proteins. One of the first proteins produced is RNA-dependent RNA polymerase, which synthesizes a complementary –ssRNA strand. That –ssRNA is then used as a template to produce many new copies of the +ssRNA genome. These copies are either translated into more proteins or packaged into new virions.

To determine which transport mechanism influenza A virus (IAV) uses to enter a host cell, we must recall cellular transport processes.

Cellular transport processes can be divided into passive, active, and vesicle-mediated transport. The nature of the molecule—its size, polarity, and chemical composition—determines which mechanism is used.

Large particles—macromolecules, fluid droplets, and entire microorganisms or viruses—are transported via vesicle formation. This energy-dependent process involves restructuring the plasma membrane.

The virus first binds to a specific cell surface receptor in receptor-mediated endocytosis. Once bound, the membrane invaginates to form a vesicle that brings the virus into the cytoplasm. The vesicle then fuses with endosomes, allowing the virus to uncoat and release its genetic material.

The opposite of endocytosis is exocytosis, where vesicles carrying substances fuse with the plasma membrane to release their contents outside the cell. In viral replication, exocytosis-like mechanisms (often with the help of viral proteins like neuraminidase) help newly assembled viruses exit the host cell.

Exocytosis is the process by which materials are exported from the cell via vesicles that fuse with the plasma membrane. This is involved in the release of newly assembled virions, not entry. The passage describes exocytosis-like behavior at the end of the viral replication cycle but not during entry, so this is incorrect.
The passage states that after binding to sialic acid on the host cell surface via its hemagglutinin (HA) protein, the IAV particle is internalized via vesicle formation. This key phrase tells us how the virus enters the cell. Vesicle formation is a hallmark feature of endocytosis, a process in which the cell engulfs extracellular material into a membrane-bound compartment that buds inward from the plasma membrane.

In this context, IAV first binds to α(2→3) or α(2→6)-linked sialic acid on glycan chains found on the surface of respiratory epithelial cells. After this binding step, the plasma membrane invaginates to form a vesicle, which encloses the virus and pulls it into the cytoplasm. This internalization mechanism is consistent with receptor-mediated endocytosis, a specific form of endocytosis used by many viruses to enter host cells.

Simple diffusion is the passive movement of small, nonpolar molecules across the plasma membrane without energy or assistance. Large macromolecules like viruses cannot pass through the lipid bilayer by simple diffusion due to their size and polarity. Therefore, this mechanism does not apply.
Facilitated diffusion involves the passive transport of polar or charged molecules across membranes using specific transmembrane proteins, without energy input. Like simple diffusion, it does not support the transport of large particles such as viruses and is not associated with vesicle formation.

Negative-sense single-stranded RNA (–ssRNA) viruses, like influenza A, carry their RNA-dependent RNA polymerase (RdRp) inside the viral particle. When the virus enters the host cell and uncoats, the RNA-dependent RNA polymerase uses the negative-sense genome as a template to synthesize complementary positive-sense mRNA transcripts. These new +RNA transcripts are then recognized by host ribosomes and translated into viral proteins.

This means the viral genome is not translated directly, but must first be transcribed into mRNA using viral RdRp.

This strategy is used by positive-sense RNA viruses (like Coxsackie B3), whose genomes function as mRNA. IAV is negative-sense RNA incompatible with ribosomal translation in its native form.
The passage describes IAV as a negative-sense, single-stranded RNA virus. This means that host ribosomes cannot directly translate the viral genome. Instead, the virus must first convert its genome into a complementary positive-sense RNA strand, which can be translated into protein.
This describes the retroviral replication strategy used by viruses like HIV. Retroviruses convert RNA into DNA using reverse transcriptase (RNA-dependent DNA polymerase), then integrate the DNA into the host genome. IAV does not use a DNA intermediate.
DNA-dependent RNA polymerase is the host’s nuclear enzyme that transcribes DNA into RNA. Influenza A is an RNA virus, and the host’s DNA-dependent enzymes cannot recognize or process viral RNA. Furthermore, the virus brings its RNA-dependent RNA polymerase, which is required to initiate transcription of its genome.

To answer this question, we must understand the basic principles of vaccines, particularly the production of antibodies and the function of memory cells.

Subunit vaccines introduce specific viral antigens—in this case, the hemagglutinin (HA) and neuraminidase (NA) proteins—without delivering the entire virus. These proteins cannot cause infection, but they are sufficient to stimulate the adaptive immune system.

Once the subunit vaccine is administered, antigen-presenting cells (APCs)—such as dendritic cells—process the viral proteins and present antigen fragments on MHC class II molecules. This activates helper T cells (CD4⁺), stimulating B cells specific to the HA or NA antigens. These B cells differentiate into plasma cells, which are the effector cells of the humoral immune response and are responsible for producing and secreting antibodies.

These antibodies bind specifically to HA or NA, thereby neutralizing the virus if the individual is exposed in the future. Therefore, the most direct and expected outcome of a subunit vaccine is the production of antibodies by plasma cells.

T cells do not produce antigens. Antigens are foreign molecules (usually proteins) that stimulate an immune response. In the case of vaccination, antigens are introduced to the immune system—T cells do not generate them.
T cells do not produce antibodies. Antibody production is the role of B cells, specifically plasma cells, which are differentiated B cells. While helper T cells assist in activating B cells, they do not directly synthesize antibodies.
Plasma cells produce antibodies, not antigens. Antigens are part of the vaccine formulation or an invading pathogen. Plasma cells are the immune system’s response to antigen exposure.
This choice describes the normal physiological response to vaccines. Plasma cells are activated B cells that secrete antibodies specific to the antigens introduced by the vaccine—in this case, the HA and NA proteins of the influenza virus.

Western blotting is a laboratory technique used to detect and identify specific proteins in a biological sample. It is a high-yield experimental method on the MCAT, especially in contexts involving protein expression, post-translational modification, or identification of antigenic proteins, such as in the case of influenza virus hemagglutinin (HA) and neuraminidase (NA).

The process begins with extracting proteins from a tissue or cell lysate. These proteins are then separated by gel electrophoresis, most commonly using SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis).

Once the proteins are separated, they are transferred from the gel to a membrane. This step is called membrane transfer and is made because membranes are more suitable than gels for subsequent antibody-based detection.

After transfer, the membrane is blocked with a nonspecific protein solution to prevent nonspecific antibody binding. The membrane is then incubated with a primary antibody that binds specifically to the target protein of interest. In the case of the influenza study, this would be an antibody specific to HA or NA subtypes. After washing, a secondary antibody is added. This secondary antibody recognizes the primary antibody and is conjugated to an enzyme. The enzyme allows for detection of the signal through a chemical reaction that produces a color change, fluorescence, or chemiluminescence, depending on the detection system used.

The result is a visualized band on the membrane corresponding to the target protein’s molecular weight. The band’s intensity can also be used to estimate the relative abundance of the protein in the sample.

This is not a step in western blotting. DNA sequencing involves analyzing nucleic acids, not proteins. Western blotting is a protein detection technique, and it does not involve reading or interpreting DNA sequences. Therefore, this is not involved in the technique and is the correct answer.
This is part of western blotting. After proteins are separated by electrophoresis, they are transferred to a membrane to allow for antibody probing.
This is also a core step in western blotting. Proteins must first be separated based on their molecular weight before they can be detected.
This is another key step in western blotting. The use of antibodies (primary and secondary) allows for specific detection of the protein of interest, such as HA or NA antigens.

A glycosidic bond is a covalent bond that links two monosaccharides together to form disaccharides, oligosaccharides, or polysaccharides. It forms between the anomeric carbon of one sugar (the carbon that was part of the carbonyl group in the open-chain form) and a hydroxyl group on another sugar. This linkage may occur in alpha (α) or beta (β) configurations, depending on the orientation of the hydroxyl group on the anomeric carbon during bond formation.

In biological systems, glycans are found on the outer surface of cell membranes and are heavily involved in cell–cell recognition, signaling, and pathogen attachment.

In the case of influenza A virus (IAV), the virus uses its hemagglutinin (HA) surface protein to bind to sialic acid residues on host cell glycoproteins. Sialic acid is a monosaccharide typically located at the terminal position of a glycan chain. It is linked to the underlying galactose via a glycosidic bond, and the configuration of this bond—either α(2→3) or α(2→6)—is species-specific. Birds primarily express α(2→3)-linked sialic acid, while humans mainly express α(2→6)-linked sialic acid. This difference in glycosidic linkage explains the variation in host susceptibility to different IAV subtypes, as described in the passage.

Importantly, glycosidic bonds are not limited to energy-storage carbohydrates like glycogen or starch. They also play a role in cell surface recognition and pathogen interaction, particularly in the context of viral entry. This makes them relevant to the MCAT, especially in passages discussing immunology, microbiology, or biochemistry.

Disulfide bonds are covalent bonds between two cysteine residues in proteins. These are protein-protein stabilizing bonds, not sugar linkages, and do not occur in carbohydrate structures like sialic acid or glycans.
The passage explains that HA binds to sialic acid, which is a monosaccharide found at the terminal position of a glycan chain. It states, “Sialic acid is a monosaccharide that links to the terminal galactose in a glycan chain via an α(2→3) or α(2→6) linkage.” This detail tells you that sialic acid is connected to another sugar molecule (galactose), and that the type of bond is dependent on the position and orientation of the glycosidic linkage (either α(2→3) or α(2→6)). This is a defining feature of glycosidic bonds, which are the covalent bonds that join monosaccharides to form disaccharides, oligosaccharides, and polysaccharides.

Therefore, when sialic acid acts as a receptor for hemagglutinin, it is covalently bonded to galactose in the glycan via a glycosidic bond. The influenza virus recognizes and binds to this carbohydrate structure, which varies slightly between species based on the glycosidic linkage configuration.

Peptide bonds are covalent bonds that link amino acids together in proteins. These are entirely unrelated to carbohydrate chemistry and are not involved in HA–sialic acid recognition.
Phosphodiester bonds are found in nucleic acids, where they link the 3′ hydroxyl of one nucleotide’s sugar to the 5′ phosphate of the next. These are not found in carbohydrate chains and have no role in glycan structure.

The question asks about the tissue that IAV most likely infects. To answer this question, we must recall the characteristics of human tissues.

The passage states, “IAV primarily infects the lining of the upper respiratory tract.”

This phrase tells us the virus targets respiratory epithelium.

Therefore, the correct tissue must be a type of epithelial tissue lining the upper airway—such as the nasal cavity, trachea, or bronchi—where the virus can bind to sialic acid residues and enter host cells.

Areolar tissue is a type of loose connective tissue, composed of fibroblasts, collagen fibers, and ground substance. It serves a structural and support role, found beneath epithelial layers and around organs, but it is not exposed to airways and is not the lining tissue of the respiratory tract. Therefore, this is incorrect.
Adipose tissue is a connective tissue specialized for fat storage. It consists of adipocytes and functions in energy storage, insulation, and cushioning. It is found subcutaneously and around internal organs, but it is not part of the epithelial lining of any mucosal surface and is not relevant to viral entry for IAV.
Transitional epithelium is a stratified epithelial tissue found almost exclusively in the urinary tract, including the bladder, ureters, and part of the urethra. Its main function is to allow for stretching and distention of the urinary organs. It is not present in the respiratory tract, so it cannot be the target of IAV.
Pseudostratified columnar epithelium tissue lines most of the upper respiratory tract, including the nasal cavity, trachea, and large bronchi. It appears to have multiple layers due to the varying positions of nuclei, but all cells are attached to the basement membrane. It contains goblet cells, which secrete mucus, and ciliated cells, which help move mucus and trapped pathogens upward.

This is the primary target tissue for respiratory viruses like IAV, which bind to sialic acid on the apical surface of these epithelial cells.

Since HA1 allows infection of both birds and humans, it must be capable of recognizing both α(2→3) and α(2→6) linkages. That means it does not strongly discriminate and is likely adapted to both receptor types.

In contrast, HA11 subtypes infect birds but not humans. Since birds predominantly express α(2→3)-linked sialic acid, and humans primarily express α(2→6), the inability of HA11 viruses to infect humans suggests that HA11 preferentially binds α(2→3)-linked sialic acid, and has low or no affinity for α(2→6).

If HA1 could not bind α(2→3), it would not infect birds, which predominantly express this linkage. Since HA1 infects both birds and humans, it must be able to bind both linkages.
HA1 infects humans, and human epithelial cells predominantly express α(2→6) linkages. So HA1 must bind α(2→6), likely as well as α(2→3).
The passage tells us that HA11 subtypes infect birds but not humans, which correlates with a preference for α(2→3) (present in birds) and poor or absent binding to α(2→6) (present in humans). This preference explains the species restriction.
If HA11 preferred α(2→6), it would be expected to infect humans, which it does not. The species tropism shows that HA11 does not bind α(2→6) efficiently.

To determine where researchers would most likely insert a gene-encoding sequence to express an exogenous protein using the pUC19 plasmid, we first need to understand the basic structure and function of a plasmid. Plasmids are small, circular DNA molecules that replicate independently of the host’s chromosomal DNA. They are widely used as vectors in molecular biology to deliver genetic material into cells. A functional plasmid used for gene expression typically contains several key elements: an origin of replication (ori), a selectable marker (such as an antibiotic resistance gene), a promoter, and a multiple cloning site, also known as a polylinker.

The plasmid shown in the figure is pUC19. First, notice that it includes an origin of replication (ori). This region ensures that the plasmid can replicate autonomously within a bacterial host. Without a functional ori, the plasmid would not be copied during cell division and would be lost from the bacterial population.

Next, the plasmid carries the ampicillin resistance gene (amp), which encodes β-lactamase. This enzyme deactivates ampicillin, an antibiotic, and allows only bacteria containing the plasmid to survive in an ampicillin-containing medium. This gene serves as a selectable marker, helping researchers identify which bacterial colonies have taken up the plasmid.

This region includes the lacZα gene, which generates a protein. This site is not typically used for gene expression since inserting an exogenous gene here would disrupt the protein function rather than facilitate proper gene expression.
The most relevant region for answering the question is the lacZα gene, within which the polylinker is located. The polylinker is a short, synthetic DNA sequence that contains multiple unique restriction sites, which means that DNA-cutting enzymes (restriction endonucleases) can recognize and cut at these sites without affecting the rest of the plasmid. This is the standard site for inserting exogenous DNA.

Therefore, if researchers want to express an exogenous protein using the pUC19 plasmid, the gene-encoding sequence should be inserted into the polylinker region within the lacZα gene, which spans approximately 396 to 454 base pairs.

This section contains the origin of replication (ori), which is important for plasmid duplication within a bacterial host. The ori ensures that the plasmid is replicated independently of the bacterial chromosome but does not contain sequences that support transcription or translation of an inserted gene. Inserting a gene here would interfere with plasmid replication and is unsuitable for protein expression.
This region includes the amp (ampicillin resistance gene), which provides resistance to ampicillin by expressing β-lactamase, an enzyme that breaks down the antibiotic. This gene is also used as a selectable marker so that bacteria that have successfully taken up the plasmid can be easily selected. Inserting a gene here would disrupt antibiotic resistance. This region is not suitable for inserting exogenous genes and their expression.

This question asks about the site where protein X-expressing cells are located in the testes. To answer it, we must understand spermatogenesis and the male reproductive structures.

Let us begin with the seminiferous tubules. The seminiferous tubules in the testes are the site of spermatogenesis, the process of sperm cell development. This process occurs in an organized, stepwise manner, with different stages of germ cells occupying distinct locations within the tubule.

Spermatogenesis begins at the outermost layer of the seminiferous tubules, where spermatogonia (stem cells) are located adjacent to the basement membrane. These cells undergo mitotic divisions, giving rise to primary spermatocytes, which then move inward toward the lumen. The primary spermatocytes undergo meiosis I, resulting in secondary spermatocytes, which rapidly proceed through meiosis II to become spermatids. As spermatids mature, they develop into spermatozoa, which are then released into the lumen of the seminiferous tubule.

The center of the lumen contains spermatozoa, the final, mature stage of sperm development. Spermatocytes will be halfway between the basement membrane and the center of the lumen.
The cells directly adjacent to the basement membrane within the seminiferous tubule are spermatogonia, the stem cells that initiate spermatogenesis. This region also contains Sertoli cells, which provide structural and metabolic support for developing sperm cells.
The Leydig cells are adjacent to the basement membrane outside the seminiferous tubules. The Leydig cells are located in the interstitial space and are responsible for producing testosterone, a hormone essential for spermatogenesis. Since spermatocytes are developing germ cells, they are located inside, rather than outside, the seminiferous tubules.
Spermatocytes represent an intermediate stage in sperm development; they are found between the basement membrane (where spermatogonia reside) and the lumen (where mature spermatozoa are located).

A Barr body is the condensed, inactivated X chromosome found in the nuclei of cells from genetic females (XX). In each female somatic cell, one X chromosome is randomly inactivated during early embryonic development to balance gene expression between XX females and XY males. The inactivated X forms a dense, compact structure at the nuclear periphery, which can be seen in stained preparations as a Barr body.

Only cells with more than one X chromosome can form Barr bodies. Furthermore, to observe a Barr body, the cell must have a visible nucleus and a nucleus in a non-dividing or interphase state (i.e., not undergoing mitosis), since Barr bodies are typically seen during interphase.

Let’s evaluate the options.

Mature red blood cells (erythrocytes) are anucleate, meaning they lack a nucleus entirely. This occurs during terminal differentiation in the bone marrow to maximize space for hemoglobin. Because they lack a nucleus, they also lack chromosomes and cannot exhibit Barr bodies, regardless of genetic sex. Therefore, mature erythrocytes always lack Barr bodies, making this the best answer.
Hepatocytes are liver cells, typically diploid and nucleated; some may even be binucleate. In a female, these cells can display Barr bodies, since they contain X chromosomes in a resting state.
Lymphocytes are nucleated white blood cells involved in immune responses. Some resting lymphocytes may exhibit Barr bodies near the nuclear membrane in females. Barr bodies are sometimes observed in peripheral blood smears using lymphocytes.
Melanocytes are pigment-producing cells located in the basal layer of the epidermis. They are nucleated, and they can contain a Barr body in females.

To answer this question, we need to understand the chemical nature of each hormone and how it relates to its signaling mechanism, specifically whether it acts through a cell surface receptor or diffuses through the plasma membrane to bind an intracellular receptor.

Peptide hormones (e.g., insulin, glucagon, TSH): These are hydrophilic, meaning they cannot cross the lipid bilayer of the plasma membrane. They bind to cell surface receptors and signal through second messenger systems.

Catecholamines (e.g., epinephrine): These are derived from amino acids (tyrosine), are also hydrophilic, and act at the cell surface via G protein–coupled receptors.

Steroid hormones (e.g., aldosterone, cortisol): These are lipophilic (hydrophobic), which allows them to diffuse through the cell membrane and bind to intracellular receptors, often in the cytoplasm or nucleus. Once bound, the hormone–receptor complex typically acts as a transcription factor, altering gene expression.

Thyroid hormones (e.g., T3 and T4): While derived from amino acids, they are lipophilic due to iodine content and can also cross the membrane to bind intracellular nuclear receptors. However, thyroid-stimulating hormone (TSH) is not a thyroid hormone—it’s a peptide hormone secreted by the anterior pituitary.

Aldosterone is a steroid hormone produced by the adrenal cortex. It is lipophilic, allowing it to diffuse across the plasma membrane of its target cells (e.g., cells in the distal nephron). It binds to intracellular receptors, and the complex modulates gene expression involved in sodium reabsorption.
Epinephrine is a catecholamine, derived from tyrosine, and is water-soluble. It cannot cross the cell membrane and instead binds to G protein–coupled receptors (GPCRs) on the cell surface, triggering second messenger cascades such as cAMP.
Glucagon is a peptide hormone secreted by pancreatic alpha cells. It is hydrophilic and acts through cell surface receptors, specifically GPCRs that activate adenylate cyclase and increase intracellular cAMP levels. This hormone does not bind to intracellular receptors.
Thyroid-stimulating hormone (TSH) is a peptide hormone produced by the anterior pituitary. It acts on the thyroid gland by binding to surface receptors (TSH receptors) on thyroid follicular cells, stimulating the production of T3 and T4. TSH itself does not bind to intracellular receptors.

This question asks what pepsin and trypsin have in common. To answer it, we must understand their main characteristics.

Pepsin is a protease that functions in the stomach. It is secreted by chief cells in an inactive form called pepsinogen. Once pepsinogen enters the acidic environment of the stomach (pH ~1.5–3.5), it is activated into pepsin, which breaks down proteins into peptides. Pepsin is most active in acidic conditions.

Trypsin is also a protease, but it functions in the small intestine. It is produced in the pancreas and secreted as the inactive zymogen trypsinogen. In the small intestine, enterokinase (also called enteropeptidase) activates trypsinogen into trypsin, which then digests proteins and activates other pancreatic enzymes. Trypsin functions best at a neutral to slightly basic pH (around pH 7–8).

Pepsin is active in the stomach’s acidic environment, while trypsin is active in the small intestine’s alkaline environment. Their optimal pH ranges are different and adapted to their respective sites of action.
Both enzymes are initially secreted in inactive forms to prevent autodigestion of the tissues that produce them. Pepsin is secreted as pepsinogen by the stomach’s chief cells, and trypsin is secreted as trypsinogen by the pancreas. Both require activation in the digestive tract to become functional proteases.
Pepsin is produced by chief cells in the stomach, while trypsin is produced by pancreatic acinar cells. These are distinct cell types located in different organs.
Both pepsin and trypsin are proteases, meaning they hydrolyze peptide bonds in proteins, not polysaccharides. Polysaccharide digestion involves enzymes like amylase, not proteases.

To determine which type of mutation CKR-5 most likely undergoes, we need to use the passage’s description and combine it with a content-based knowledge of genetic mutations and their effects on protein structure.

Let’s review the mutation types first. Missense mutation is a point mutation that changes one codon to another, leading to a different amino acid. This usually changes just one amino acid and does not cause a major shift in the protein sequence. Nonsense mutation is a point mutation that converts a codon to a stop codon, resulting in premature termination of translation. A frameshift mutation is caused by an insertion or deletion that is not a multiple of three, which shifts the reading frame and alters every downstream amino acid, often leading to a nonfunctional or truncated protein.

Promoter and intronic regions are non-coding regions. Mutations in promoters or introns typically do not directly affect amino acid count, although they can impact transcription regulation or splicing.

Missense mutations alter protein sequence, but intronic regions are non-coding, so they cannot directly change the amino acid count. Additionally, missense mutations affect only one amino acid, not 38.
Again, a missense mutation changes a codon to one encoding a different amino acid, but the promoter is a non-coding regulatory region. Changes here affect transcription initiation, not protein length.
Nonsense mutations introduce a stop codon, but promoter regions are not translated, so stop codons are irrelevant.
The passage tells us, “People who are homozygous for a 32-nucleotide deletion, resulting in 38 fewer amino acids in the sequence of CKR-5, are resistant to HIV infection.” This gives us two important pieces of information: There is a deletion of 32 nucleotides in the CKR-5 gene. This deletion leads to a truncated protein—specifically, the final protein product is 38 amino acids shorter than normal.

This implies that the mutation affects the coding (exonic) region, since it leads to a shortened protein, which means the amino acid sequence has been altered. A deletion that is not in a multiple of 3 (in this case, 32 nt) leads to a frameshift, which alters the reading frame of the mRNA and causes aberrant translation, usually resulting in a premature stop codon and a truncated, nonfunctional protein.

The passage explains that one of the major obstacles in curing HIV is the virus’s ability to remain latent within infected host cells. During latency, the viral genome is integrated into the host DNA. Still, it remains transcriptionally silent, meaning the infected cells do not express HIV proteins and are not detected or eliminated by the immune system. To address this, researchers have developed latency-reversing agents (LRAs), such as histone deacetylase inhibitors. These compounds prevent the removal of acetyl groups from lysine residues on histone proteins. According to the passage, using LRAs stimulates virus production, allowing the immune system to recognize and eliminate infected cells.

To understand how this works, we should recall how chromatin structure and histone modifications regulate gene expression. DNA is wrapped around histone proteins to form nucleosomes, and the state of chromatin can vary from tightly packed (heterochromatin) to loosely packed (euchromatin). Heterochromatin is transcriptionally inactive because it restricts access of transcription factors to the DNA, whereas euchromatin is transcriptionally active due to its relaxed structure, which allows transcription machinery to bind. A key regulatory mechanism is the acetylation of lysine residues on histones. Acetylation neutralizes the positive charge of lysine, weakening the interaction between histones and negatively charged DNA. This promotes the formation of euchromatin, which facilitates transcription. On the other hand, histone deacetylases (HDACs) remove these acetyl groups, restoring the histone-DNA interaction and promoting heterochromatin formation, thereby silencing gene expression.

When an LRA such as an HDAC inhibitor is used, it blocks deacetylation, increasing histone acetylation. This leads to a shift in chromatin toward a more open, euchromatic state, which allows transcription factors to access the viral genome. As a result, the transcription of previously latent HIV provirus is reactivated, viral proteins are produced, and the immune system can recognize and eliminate the infected cell. This mechanism underlies the “shock and kill” strategy for HIV eradication.
Euchromatin is the open, accessible form of chromatin. It facilitates, not prevents, transcription factor binding.
Heterochromatin is compact and transcriptionally inactive, restricting access to transcription factors.
While it’s true that heterochromatin prevents access, the passage clearly states that the LRA promotes transcription, so it must be acting to reduce heterochromatin, not increase it.

To answer this question, we must use the passage’s description of nucleotide reverse transcriptase inhibitors (NRTIs) and combine that with our knowledge of nucleic acid synthesis.

Each new nucleotide is added to the growing strand’s 3′ hydroxyl (–OH) group during DNA or RNA synthesis. The bond that forms is a phosphodiester linkage, which connects the 3′ hydroxyl group of the last nucleotide to the 5′ phosphate group of the incoming nucleotide. Specifically, the bond that forms is an O–P bond, where the oxygen from the 3′ hydroxyl forms an ester bond with the phosphorus of the incoming nucleotide’s phosphate group.

NRTIs lack a 3′ hydroxyl group, which means they cannot form this O–P bond, so no new nucleotide can be added, leading to chain termination. This is the basis of their antiviral activity—they inhibit the elongation of viral DNA during reverse transcription.

C–N bond is involved in peptide bonds (between amino acids) and the base-sugar linkage of nucleotides (N-glycosidic bond). Still, it is not the bond formed during nucleotide polymerization.
While carbon–oxygen bonds are present in sugar structures and glycosidic linkages, they are not the defining bond in nucleotide chain elongation. This is not the correct bond being prevented by NRTIs.
Nitrogen–oxygen bonds are not typically found in DNA or RNA backbones. This is not relevant to nucleic acid synthesis.
The oxygen of the 3′ hydroxyl group forms a phosphodiester bond with the phosphate of the next nucleotide. Without the 3′ hydroxyl (as in NRTIs), the O–P bond cannot form, and the chain cannot be extended.

To determine the value of the expression. In reversible binding between a ligand (here, Compound 1) and a target protein (HIV protease), the equilibrium association constant describes how tightly the ligand binds to the protein. According to the passage, Compound 1 binds to the active site of HIV protease with a dissociation constant (Kd) of 4×10−3 nM The dissociation constant represents the ratio of unbound reactants to the bound complex at equilibrium and is given by the expression:

In contrast, the association constant Ka is simply the inverse of this expression. It is defined as the concentration of the bound complex divided by the product of the concentrations of the unbound reactants:

If correct, it would imply a higher Kd, meaning weaker binding affinity between Compound 1 and HIV protease. But the passage gives a very low Kd value (0.004 nM), corresponding to very tight binding—so a low Ka like 160 nM−1 is inconsistent with that data.
This choice is twice the correct value and implies a lower Kd than what was provided in the passage. Specifically, if Ka=500 nM−1, that would mean Kd=1/500=0.002 nM, half the actual dissociation constant. While it still reflects high affinity, it’s too strong compared to the given data.
This choice corresponds to an even lower Kd of approximately 0.0013 nM, suggesting ultra-tight binding, which again does not match the Kd=0.004 nM stated in the passage.

This question asks about the most likely outcome of an LRA treatment on the viral load of an HIV-infected person who is also treated with ART. To answer this question, we understand the passage well.

The passage explains that the main obstacle to curing HIV is that the viral genome can remain dormant in infected cells. These cells do not express HIV antigens, evading immune detection and persist even when ART suppresses active viral replication. The passage then introduces latency-reversing agents (LRAs), which are described as compounds such as histone deacetylase inhibitors that stimulate virus production from these dormant cells by promoting euchromatin formation and enabling transcription of the latent viral genome.

The goal of using LRAs is to force latent HIV out of hiding—this is sometimes referred to as the “shock and kill” strategy. The shock phase reactivates the virus, leading to expression of viral proteins, while the kill phase relies on immune recognition and/or ART to eliminate the now-detectable infected cells.

Given this understanding, the most likely sequence of events in a patient on ART who receives LRA treatment would be latent virus reactivation, which causes an initial sharp increase in viral load as the dormant virus becomes transcriptionally active. The immune system and ART target the newly active virus and infected cells, decreasing viral load after the initial spike.

Although the viral load increases initially due to LRA-induced reactivation, it does not remain elevated. ART prevents viral replication, and the immune system clears the reactivated virus, leading to a decline in viral load rather than plateauing.
LRAs increase euchromatin levels and stimulate viral transcription, which causes an initial increase in viral load rather than a decrease. The increase occurs because latent viruses become active, increasing the number of viral particles in circulation. Therefore, an initial sharp decrease is not expected.
The passage notes that LRAs, such as histone deacetylase inhibitors, prevent deacetylation of lysine residues in the chromatin-associated histones, thus stimulating virus production, resulting in viral elimination by the immune system. From the previous sentence, we conclude that LRAs function by reactivating latent HIV within infected cells. The passage explains that LRAs prevent lysine residues’ deacetylation in histones, promoting euchromatin formation. This relaxed chromatin structure allows transcription factors to access viral genes, increasing viral gene expression and virus production. This initially causes a sharp increase in the viral load as dormant HIV becomes transcriptionally active. However, since the patient is also being treated with antiretroviral therapy (ART), the newly produced viral particles cannot replicate effectively due to the inhibition of key viral enzymes like reverse transcriptase and protease. Additionally, the immune system can now recognize and target infected cells that were previously latent. As a result, after the initial spike in viral load, there is a subsequent decrease due to viral elimination by the immune response and ART-induced suppression.
LRAs do not directly decrease viral load at first. Instead, they increase viral production, leading to an initial increase in viral load. This choice incorrectly reverses the expected sequence of events. Since ART is present, viral replication is suppressed after initial reactivation, leading to a decrease rather than a secondary increase in viral load.

To determine which characteristic correctly describes the infectious agent studied in this passage, we must identify the type of organism and apply our knowledge of cell biology.

Plasmodium falciparum is a eukaryotic cell, meaning it contains a membrane-bound nucleus and various membrane-bound organelles.

Given that it is a eukaryotic protozoan, it will certainly have a nucleus, nucleic acids (it has DNA and RNA), no capsid because it is not a virus, and intracellular organelles like mitochondria and an endomembrane system.

Plasmodium falciparum is a eukaryote, and all eukaryotic cells have a nucleus. Its nuclear material can be visualized in microscopy during some life stages.
As a living cell, P. falciparum has a complete genome of DNA, which uses RNA for transcription and translation.
A capsid is the protein shell of a virus, used to encase viral genetic material. P. falciparum is not a virus and does not have a capsid.
The passage states that researchers used ELISA and blood smears to detect infection by “Plasmodium falciparum, the causative agent of malaria.” So, the infectious agent in question is Plasmodium falciparum, a protozoan parasite—a eukaryotic, single-celled organism. This immediately tells you it is not a virus and not a bacterium. Instead, it belongs to the kingdom Protista and is classified as an eukaryotic parasite.

Being a eukaryotic protozoan, Plasmodium falciparum has membrane-bound organelles, including a nucleus, mitochondria, and ER.

To answer this question, we need to determine which type of microscope would be most appropriate for verifying the presence of Plasmodium falciparum, based on the method described in the passage and our knowledge of microscopy techniques.

A light microscope (a brightfield microscope) uses visible light and optical lenses to magnify specimens. It is the standard tool for viewing stained blood smears and is routinely used in clinical labs to identify Plasmodium species in red blood cells. It has sufficient resolution (around 200 nm) to observe cells, nuclei, and intracellular parasites.

A confocal microscope uses laser-based scanning and fluorescence to generate high-resolution, optically sectioned images, often in 3D. While it provides more detailed images than conventional light microscopy, it requires fluorescent labeling and is typically used in cell biology research, not in routine clinical or field-based diagnosis. It is not used for viewing stained blood smears, and its capabilities exceed those needed to identify Plasmodium.
The passage states, “Researchers used enzyme-linked immunosorbent assay (ELISA) and blood smear analysis to verify the presence of Plasmodium falciparum…” This tells us that the researchers visually assessed blood smears, a standard clinical technique for observing cells and parasites in stained blood under a microscope. This technique relies on visible light and typically uses staining protocols such as Giemsa stain, which helps highlight Plasmodium inside erythrocytes.
A scanning electron microscope (SEM), provides detailed three-dimensional images of specimen surfaces by scanning them with an electron beam. SEM cannot visualize internal structures of cells or parasites, and it requires that specimens be dehydrated and coated in metal, which destroys cellular architecture and prevents detection of intracellular features. It is not suitable for detecting Plasmodium in red blood cells.
A transmission electron microscope (TEM), can provide very high-resolution images of internal cell structures, including organelles and even viruses. However, it requires ultrathin sample sections, extensive sample preparation, and cannot be used on routine stained blood smears. Although it could theoretically identify Plasmodium, it is not practical or necessary for identifying parasites in clinical or field research. It is reserved for research-level ultrastructural analysis, not standard diagnostics.

To answer this question, we must focus on what the passage tells us about the ABO gene and how it relates to variation in blood type antigens. We also need to integrate our knowledge of polymorphism.

The first two sentences of the passage tells us two essential facts. There is a single gene (the ABO gene) responsible for producing the enzyme that determines blood type antigens. The gene exists in multiple forms (alleles)—specifically the A, B, and O alleles—that result in different phenotypes, which correspond to the different blood types.

The passage specifically uses the term “polymorphisms”, which in genetics refers to the presence of two or more alleles at a locus, each occurring in at least 1% of the population. That’s a textbook definition of a polymorphic gene, and it directly leads to one of the answer choices.

This describes a pseudogene, a nonfunctional copy of a gene that has lost its ability to produce a functional protein. Pseudogenes typically arise from gene duplication events followed by mutations that disable gene expression. However, the ABO gene system is not silent and is not a duplication of another gene. the ABO gene is functional and actively encodes glycosyltransferase. The O allele is nonfunctional due to a deletion, but it is not a pseudogene—it is simply an inactive allele within a functional gene.
This describes orthologous genes, which are genes in different species that evolved from a common ancestral gene and retain similar functions. The passage does not discuss the ABO gene’s presence in other species, nor does it compare its function across species.
This describes paralogous genes, which are gene duplicates within the same species that have evolved different functions. The ABO gene system is only one gene carrying a DNA mutation in the same species. The ABO gene does not encode multiple proteins with different functions—it encodes variations of the same glycosyltransferase enzyme with antigen-specific modifications.
This matches both the text of the passage and the definition of a polymorphism. The ABO gene has multiple alleles (A, B, and O), each of which is found in more than 1% of the human population, and this genetic diversity gives rise to the four major blood groups. The passage directly states that polymorphisms in the ABO gene are common, which confirms this.

This question asks about the sequence of enzymes used for RFLP that most likely recognize. To answer this question, we must understand the principles of restriction enzyme recognition and palindromic sequences.

Most restriction endonucleases recognize palindromic sequences that are 4–8 base pairs long. A palindrome in DNA refers to a sequence that reads the same 5′ to 3′ on one strand as it does 5′ to 3′ on the complementary strand.

Restriction enzymes bind to these palindromic sites and cut the DNA, generating restriction fragments. These fragments can be separated by electrophoresis and analyzed for polymorphisms.

This sequence is palindromic. Its complement would be 3′–CTTTAAAG–5′, which is the reverse of the original. This would be a typical recognition site.
This is also not palindromic. The complementary strand would be 3′–GTTTAAAG–5′, again not matching the original in reverse.
This is not palindromic. The complement is 3′–CTTAATTG–5′, which is not the reverse of the original. This sequence satisfies the requirement for recognition by a restriction enzyme used in RFLP analysis.
This is not palindromic. Its reverse complement is 3′–CTAATAAG–5′, which is not the reverse of the original.

To determine the most likely pattern of inheritance for the ABO blood group alleles described in Table 1 of the passage, we need to interpret the phenotypes produced by various genotypes and apply our knowledge of Mendelian inheritance patterns.

The passage tells us that the ABO gene has several alleles (A, B, and O), and Table 1 lists these genotypes along with their corresponding phenotypes:

| Alleles | Phenotype |
| :—- | :—- |
| AA | A |
| AO | A |
| AB | AB |
| BB | B |
| BO | B |
| OO | O |

This table shows how combinations of different alleles determine an individual’s blood type phenotype. Let’s now use this data to analyze the inheritance pattern.

The ABO gene displays two key genetic principles.

Codominance – Both the A and B alleles are codominant, meaning that both are expressed equally when present together in the AB genotype. In this case, neither allele masks the effect of the other, and both A and B antigens are expressed on red blood cells.

Recessiveness of O – The O allele is recessive to both A and B. It produces no functional enzyme (due to a deletion), and contributes no antigen to the red blood cell surface. Individuals with AO or BO genotypes express A or B phenotype, respectively, showing that A and B each completely dominate O.

A is not recessive; in both AA and AO genotypes, the phenotype is A, meaning A is dominant over O. So this contradicts the table.
If A showed incomplete dominance, then AO individuals would show a phenotype intermediate between A and O, which is not observed. AO still produces an A phenotype, which indicates complete dominance over O.
A and B are codominant, as demonstrated by the AB genotype producing the AB phenotype, with both antigens expressed. The O allele is recessive, as shown by AO and BO genotypes producing A and B phenotypes, respectively.
The B allele is not recessive—BO results in a B phenotype, and AB shows both A and B, meaning B is also dominant over O, and codominant with A, not recessive.

The question asks which ABO allele is most strongly associated with an increased risk of malaria infection. To answer this, we must analyze the data from Table 1 and understand the relationship between different ABO genotypes and Plasmodium falciparum infection rates.

The table provides data on the percentage of individuals infected with malaria for each ABO genotype. Our strategy should focus on finding highest infection percent first, seeing what allele is common to those genotypes, and picking the answer that includes that allele only.

If the A allele were responsible for increased susceptibility, then AA individuals should have a high infection rate. However, the infection rate for AA individuals is only 20%. In comparison, AO individuals (who carry one O allele) have a much higher rate of about 45%, indicating that the O allele contributes to the increased infection risk rather than the A allele.
The B allele is incorrect only because BB individuals have an infection rate of 20%, which is the same as AA individuals, and BO individuals have a about 34% infection rate. The data suggests that the O allele contributes to the increased risk, as BO individuals have a higher infection rate than BB individuals.
Let’s immediately find the genotype with the highest number of infected individuals out of the smallest total tested — that gives us the highest infection percentage.

AO: 21 infected out of 46 tested → ~46%

OO: 63 out of 150 → ~42%

BO: 9 out of 26 → ~35%

What allele is common to all three of these? The O allele.

What about AA, BB, AB? All have low infection rates (20–25%), and they don’t have the O allele.

From these values, individuals with at least one O allele (AO, BO, and OO) have higher infection rates than individuals with only A or B alleles (AA, BB, AB), suggesting that the O allele is most strongly associated with malaria susceptibility.

The presence of A or B alone (in AA or BB) correlates with lower infection rates.

This question asks about the first cellular process affected by inhibiting spindle fiber elongation during cell division. To answer this question, we must understand the principles of mitosis and the role of spindle fibers in organizing and moving chromosomes during cell division.

Spindle fibers are microtubule-based structures that form the mitotic spindle for proper chromosome alignment and segregation. These fibers originate from centrosomes and undergo dynamic changes in length by polymerizing (elongating) and depolymerizing (shortening) their tubulin subunits. Each stage of mitosis relies on specific behaviors of these microtubules.

The first step that depends on microtubule elongation is the formation of asters. Asters are star-shaped microtubule arrays that form around each centrosome early in prophase, before the nuclear envelope breaks down or spindle microtubules begin to interact with chromosomes. Aster formation results from the outward growth of short microtubules from the centrosome into the surrounding cytoplasm.

If a cell is treated with a compound that blocks microtubule (spindle fiber) elongation, the initial formation of asters would fail, preventing all downstream spindle functions, including chromosome attachment and movement.
This process occurs later in prometaphase, after forming the spindle fibers. The inhibition of spindle elongation would indirectly affect fiber attachment, but the lack of asters happens first, making it a secondary consequence rather than the initial effect.
Chromosome alignment on the midline happens during metaphase, a stage after prophase and prometaphase. Since proper chromosome positioning depends on functional spindle fibers, it would be disrupted due to the absence of asters. However, this is not the first affected process; the initial disruption occurs earlier with aster formation.
This occurs during anaphase, when spindle fibers pull sister chromatids apart. Since spindle fibers originate from the asters, their absence would affect chromosome movement, which happens later in the process.

This question asks about the structural and functional characteristics of tRNA. To answer this question, we must recognise the RNA structure and how it interacts with amino acids during protein synthesis.

tRNAs are structural RNA molecules that bind to specific codons on the mRNA template and add the corresponding amino acid to the polypeptide chain. Therefore, tRNAs are the molecules that actually “translate” the language of mRNA into the language of proteins. In eukaryotes, tRNAs are transcribed by RNA polymerase III. tRNAs have a cloverleaf shape when drawn as a 1D chain but actually fold into a distinct 3D structure (see the image below).

Each tRNA has a sequence of three nucleotides located in a loop at one end of the molecule (shown at the bottom of the figure) that can basepair with an mRNA codon. This is called the tRNA’s anticodon. Each different tRNA has a different anticodon. There are different tRNAs for each of the 21 different amino acids, and most amino acids can be carried by more than one tRNA. Each tRNA binds to one amino acid at the end opposite its anticodon. Aminoacyl tRNA synthetases are enzymes that load individual amino acids onto the tRNAs. When the tRNA anticodon basepairs with one of the mRNA codons, the tRNA will add an amino acid to the growing polypeptide chain or terminate translation, as described above. For instance, if the sequence CUA occurred on a mRNA template in the proper reading frame, it would bind a tRNA with an anticodon expressing the complementary sequence, GAU. The tRNA with this anticodon would be linked to the amino acid leucine.

tRNA is a single-stranded RNA molecule, not a double-stranded one like double-stranded RNA (dsRNA) or DNA. Additionally, tRNA is much shorter, consisting of approximately 80 nucleotides, not 1000.
tRNA is a single-stranded RNA molecule; however, it is only about 80 nucleotides long, not 1000.
Transfer RNA (tRNA) plays a role in translation by carrying specific amino acids to the ribosome. Each tRNA molecule has a CCA sequence at its 3′ end, where an amino acid is covalently attached by aminoacyl-tRNA synthetase. This amino acid is then incorporated into the growing polypeptide chain during protein synthesis.
tRNA does not directly bind to ribosomes in this manner. Instead, mRNA contains the ribosome-binding site. tRNA interacts with ribosomes through its anticodon region, which pairs with codons on mRNA during translation, but its 5′ end does not serve as a ribosome attachment site.

This question asks about transformation efficiency in bacterial cells. To answer this question, we must recall how to calculate transformation efficiency, which measures how effective the transformation process was. The formula for transformation efficiency is:

Transformation efficiency = Number of colony-forming units (CFU) obtained / Micrograms of DNA used in transformation

The table shows that the DNA concentration is 0.005 µg/µL and that 10 µL of DNA was used in the transformation. By multiplying these values, we can calculate the total amount of DNA used

0.005 μg/μL × 10 μL = 0.05 μg

Next, we must determine how much of the transformation mixture was plated. After combining the DNA with bacterial cells, the total volume is 10 µL + 490 µL = 500 µL. However, only 100 µL of that mixture was plated, which means one-fifth (⅕) of the total transformation reaction was plated.

This calculation does not take into account the total volume of DNA (10 µL) used in the experiment. It likely assumes a different fraction of DNA was plated than what was actually used.
We are told that 4 colonies were observed on the plate, representing only a fraction of the total number of transformed colonies. To estimate how many total colonies were generated in the entire reaction, multiply the 4 observed CFUs by 5:

4 × 5 = 20 CFUs

Now, apply the transformation efficiency formula. We divide the estimated total number of CFUs (20) by the amount of DNA used (0.05 µg):

20 / 0.05 = 400 CFU/μg

The transformation efficiency is 400 colony-forming units per microgram of DNA.

This calculation would be valid only if 10 µL of the transformation mixture, rather than 100 µL, had been plated. Since 100 µL was actually spread, the transformation efficiency is higher than 40 CFU/µg.
This value assumes that the entire 500 µL transformation mixture was plated instead of just 100 µL. Since only a fraction of the total DNA was spread, the transformation efficiency must be adjusted accordingly, making 4 CFU/µg too low.

This question asks about enzyme inhibition and its effects on kinetic parameters (KM and Vmax). To answer this question, we must understand the principles of enzyme kinetics, Michaelis-Menten parameters, and types of enzyme inhibition.

Two important terms in Michaelis-Menten kinetics are Vmax, which is the maximum rate of the reaction when all the enzyme’s active sites are saturated with substrate, and KM (also known as the Michaelis constant), the substrate concentration at which the reaction rate is 50% of Vmax.

Non-competitive inhibition is a type of allosteric inhibition in which the inhibitor binds to a site other than the active site. This binding does not affect substrate binding affinity, so KM remains unchanged. However, the inhibitor reduces the enzyme’s catalytic activity, resulting in a lower Vmax.

A competitive inhibitor increases KM while leaving Vmax unchanged. Compound A shows an increase in KM from 0.82 to 1.6 mM, but Vmax remains nearly the same (3.26 to 3.38 mM/min), characteristic of competitive inhibition. This occurs because competitive inhibitors bind to the enzyme’s active site, requiring a higher substrate concentration to reach the same reaction rate.
A non-competitive inhibitor reduces Vmax while leaving KM unchanged. In the table, Compound B shows a Vmax decrease from 3.26 to 2.1 mM/min, while KM remains nearly the same at 0.81 mM compared to the control (0.82 mM). This matches the characteristic behavior of non-competitive inhibition, where the inhibitor binds to an allosteric site, preventing enzyme function without affecting substrate binding affinity.
Compound C decreases the KM to 0.41 mM, while the Vmax remains unchanged at 3.30 mM/min. A decreased KM indicates increased substrate affinity, but without any change in Vmax, this does not match any classic inhibition model very well. It does not align with non-competitive inhibition, which would require a decreased Vmax.
Uncompetitive inhibitors decrease both KM and Vmax. Compound D lowers KM from 0.82 to 0.52 mM and reduces Vmax from 3.26 to 2.1 mM/min, characteristic of uncompetitive inhibition. Uncompetitive inhibitors bind to the enzyme-substrate complex, locking the substrate in place and reducing the overall reaction rate.

To identify which molecules are represented by 1 and 2 in Figure 1, we must interpret the diagram in the context of the clotting and fibrinolytic pathways described in the passage.

In Figure 1, two opposing processes are shown:

Clotting pathway (left side): The coagulation cascade leads to molecule 1, which then activates thrombin, converting fibrinogen into fibrin, leading to clot formation.

Fibrinolysis pathway (right side): Molecule 2 comes after plasminogen and breaks fibrin into FDPs (fibrin degradation products).

Prothrombin is the precursor of thrombin, a protease responsible for the clotting process, and plasmin is derived from plasminogen and plays a role in fibrinolysis. In the clotting cascade, prothrombin is converted into thrombin, which then catalyzes the polymerization of fibrinogen into fibrin, forming a stable clot. On the other hand, fibrinolysis is the process that dissolves clots, where plasminogen is converted into plasmin, an enzyme that breaks down fibrin into fibrin degradation products (FDPs), preventing excessive clot formation.

Antithrombin is an anticoagulant protein that inhibits thrombin and other serine proteases involved in clotting. However, it does not participate in activating thrombin from prothrombin, and prothrombin is not derived from plasminogen.
Prothrombin is not derived from plasminogen and is identified as a precursor in clotting. Antithrombin is not involved in the conversion of prothrombin to thrombin. Antithrombin is an anticoagulant protein that does not participate in the clotting process that leads to the formation of thrombin.
Molecule 1 is upstream of thrombin → It must be prothrombin, the inactive precursor that gets cleaved to form thrombin during the clotting cascade.

Molecule 2 appears downstream of plasminogen and is responsible for degrading fibrin → This is plasmin, the active enzyme that breaks down fibrin during fibrinolysis.

Plasmin derives from the activation of plasminogen. Therefore, it participates in fibrinolysis, not clot formation, which does not serve as the precursor of thrombin. While plasmin is derived from plasminogen, prothrombin generates thrombin, which is required for clot formation.

To answer this question, we need to recall what the passage stated about the enzymes involved in the coagulation cascade and then match that information to the correct amino acid structure.

The passage notes, “During clotting, several coagulation-specific factors activate serine proteases.” This statement tells us that the catalytic activity of the enzymes in the coagulation cascade depends on the presence of the amino acid serine in their active sites. Serine proteases are enzymes that use the hydroxyl group of serine to carry out nucleophilic attacks, particularly for cleaving peptide bonds during proteolytic reactions.

This is alanine (side chain: –CH₃). Lacks a hydroxyl group.
This is glutamic acid (–CH₂CH₂COOH). Acidic side chain, not catalytic in serine proteases.
Serine is a polar, uncharged amino acid with the following side chain:

* –CH₂OH (a hydroxymethyl group)

This means the side chain has a hydroxyl (-OH) group bonded to a methylene (-CH₂-) carbon for catalytic activity in serine proteases.

This is lysine (–(CH₂)₄NH₃⁺). Basic side chain, not used in serine protease catalysis.

This question asks about the primary organ responsible for producing coagulation and fibrinolysis factors.

The passage describes two opposing processes, clotting and fibrinolysis. All of these proteins—clotting factors, fibrinogen, plasminogen, and various serine proteases—are soluble plasma proteins that circulate in the blood in inactive form and are activated at sites of vascular injury.

The liver is the primary organ responsible for producing most clotting factors involved in the coagulation cascade, including fibrinogen, prothrombin, and other coagulation factors. Additionally, the liver produces anticoagulant proteins and factors involved in fibrinolysis, such as plasminogen.

Since the processes of clotting and fibrinolysis rely on liver-produced proteins, the liver is the correct answer.
The spleen plays a role in immune function and blood filtration. It helps remove old or damaged red blood cells and detects pathogens in the bloodstream, but it does not synthesize clotting factors.
The pancreas is primarily involved in digestion and blood sugar regulation. It produces digestive enzymes like lipases, amylases, and proteases to break down food, and insulin and glucagon to control blood sugar. However, it does not produce coagulation factors.
The small intestine is responsible for nutrient absorption and digestion. It produces digestive enzymes such as maltase, sucrase, and peptidases but does not contribute to clotting or fibrinolysis.

This question asks about the precursor cells that produce the cellular fragments involved in clot formation. To answer this question, we must recall hematopoiesis (blood cell formation) and the role of platelets in clotting.

A clot comprises a fibrin mesh (formed from fibrinogen by thrombin) that traps platelets, which are cellular fragments critical for the initial response to vascular injury. These fragments are not whole cells; they lack nuclei and contribute to plugging the damaged site, aggregating at the wound, and releasing granules that further promote clotting.

Platelets, also known as thrombocytes, are small, disc-shaped, anucleate cellular fragments that play a role in blood clotting by forming a plug at the site of vessel injury and reinforcing the fibrin mesh. Platelets originate from megakaryocytes, which reside in the bone marrow and produce thousands of platelets by shedding small cytoplasmic fragments into the bloodstream.
Monocytes are white blood cells (leukocytes) that function in the immune system rather than clotting. They are the largest type of leukocytes and differentiate into macrophages and dendritic cells, which are involved in phagocytosis and antigen presentation. Monocytes do not produce platelets or contribute to blood clotting.
Lymphocytes (T, B, and natural killer (NK) cells) are essential for adaptive immunity, playing key roles in immune responses and antibody production. They are not involved in platelet production or clot formation. Since the passage states that the fibrin mesh catches platelets, it is clear that platelets, not lymphocytes, are involved in clotting.
Progranulocytes develop from myeloblasts and are precursors of granulocytes, which include neutrophils, eosinophils, and basophils. These cells are part of the immune response and are not involved in clot formation. Since progranulocytes develop into myelocytes and eventually mature into granulocytes, they do not differentiate into megakaryocytes or platelets.

This question asks about the characteristics of the hormone whose high plasma levels are associated with a higher risk of thrombosis.

The passage indicates that high estrogen levels are linked to increased circulating clotting factors and a higher risk of thrombosis.

Estrogen is a steroid hormone, which means it is lipophilic and synthesized in the smooth endoplasmic reticulum (ER). Since it is a lipid-soluble hormone, it can diffuse across the cell membrane and bind to intracellular receptors in the cytosol. Once bound to its receptor, the estrogen-receptor complex crosses the nuclear membrane and functions as a transcription factor to regulate gene expression, including the synthesis of clotting factors.

Estrogen circulates bound to sex hormone-binding globulin or albumin, not clotting factors. Clotting factors are precursors of active enzymes that freely circulate in their inactive form.
Estrogen binds to its specific cytosolic receptors and functions as a transcription factor, rather than interacting with its receptor to inhibit protein degradation.
Estrogen is a lipid, not a protein, so it is synthesized in the smooth ER instead of the rough ER. Additionally, estrogen functions as a transcription factor rather than an enzyme activator when it binds to its receptor.
Estrogen is synthesized in the smooth ER. Upon entering target cells, it binds to an intracellular receptor and functions as a transcription factor, increasing the expression of various genes, including those involved in blood clotting.

To answer this question, we need to identify which structure had high CRF (corticotropin-releasing factor) levels in Experiment 2, and then determine what that same structure produces “other hormone”.

The hypothalamus is the main neuroendocrine control center. It integrates signals from the nervous system and regulates the activity of the pituitary gland, which in turn controls peripheral endocrine organs.

The hypothalamus releases and inhibits hormones secreted into the hypophyseal portal system, directly affecting the anterior pituitary.

TRH (thyrotropin-releasing hormone) → stimulates TSH release

CRH (corticotropin-releasing hormone) → stimulates ACTH release

GnRH (gonadotropin-releasing hormone) → stimulates FSH and LH release

GHRH (growth hormone-releasing hormone) → stimulates GH

Somatostatin → inhibits GH

Dopamine → inhibits prolactin

In addition, the hypothalamus produces hormones such as oxytocin and vasopressin (ADH), which are transported via neurons to the posterior pituitary, where they are stored and released into circulation.

FSH is a gonadotropin hormone produced and secreted by the anterior pituitary, not the hypothalamus. It stimulates gamete production (spermatogenesis in males and follicular development in females) and is regulated by gonadotropin-releasing hormone (GnRH) from the hypothalamus.
Growth hormone is also produced by the anterior pituitary, not the hypothalamus. The hypothalamus regulates GH secretion through two hormones: growth hormone-releasing hormone (GHRH), which stimulates GH release, and somatostatin, which inhibits it.
Prolactin is another hormone the anterior pituitary produces, not the hypothalamus. The hypothalamus regulates prolactin secretion by producing dopamine, which inhibits prolactin release.
In Experiment 2, the researchers observed “Increased hypothalamic levels of CRF in GF mice when compared to SPF mice.” This tells us that the structure with elevated CRF is the hypothalamus. The question asks us to find which other hormone the hypothalamus produces and triggers the HPA axis response.

The paraventricular nucleus of the hypothalamus produces CRF and acts on the anterior pituitary to stimulate ACTH release. This is part of the hypothalamic–pituitary–adrenal (HPA) axis involved in the stress response. The hypothalamus is a key neuroendocrine structure that regulates the body’s stress response by producing CRF, which stimulates the anterior pituitary to release adrenocorticotropic hormone (ACTH), leading to cortisol secretion from the adrenal glands.

In addition to CRF, the hypothalamus produces vasopressin (antidiuretic hormone, ADH), which is released into circulation via the posterior pituitary. Vasopressin plays a role in water retention and blood pressure regulation by acting on the kidneys to increase water reabsorption. Additionally, vasopressin can enhance the stress response by modulating ACTH release. Vasopressin is one of the hormones the hypothalamus produces, which is then released from the posterior pituitary, making it the best answer.

The question asks which structure is closest to the CRF-producing structure, which is the hypothalamus.

To answer this question, we must understand brain anatomy, the relative locations of different brain structures, and their functional roles.

The passage states that CRF (corticotropin-releasing factor) levels were elevated in the hypothalamus, making it the structure of interest. CRF is produced in the paraventricular nucleus of the hypothalamus, which is located just above the brainstem and forms the floor of the third ventricle. It is part of the diencephalon, which also includes the thalamus. So to answer this, you need to know where each choice is relative to the hypothalamus.

The cerebellum is located near the brainstem at the back of the brain. It is much farther from the hypothalamus than the thalamus. The cerebellum is primarily responsible for motor coordination and balance.
The medulla oblongata is located at the base of the brainstem and is responsible for autonomic functions such as respiration and heart rate. It is significantly farther from the hypothalamus than the thalamus.
The occipital lobe is located at the posterior part of the brain and is responsible for visual processing. This region is much farther from the hypothalamus than the thalamus.
The thalamus is superior to the hypothalamus and is a major relay center for sensory and motor information in the brain. Among the options given, the thalamus is the structure closest to the hypothalamus.

This question asks about the type of hormone that shows the highest fold increase after 1 h of restraint and how it will circulate in the blood. To answer this question, we need to analyze Figure 1 to determine which hormone shows the highest fold increase after 1 hour of restraint stress in GB E. coli mice and recall how different types of hormones circulate in the blood.

In Figure 1, we see two panels. The upper panel shows levels of ACTH, a peptide hormone secreted by the anterior pituitary. In GB E. coli mice, ACTH levels rise from a basal level of around 50 pg/mL to about 250 pg/mL after 1 hour of restraint, reflecting approximately a 5-fold increase.

The lower panel shows corticosterone, a steroid hormone secreted by the adrenal cortex. In the same group of mice (GB E. coli), corticosterone levels increase from a basal level of approximately 20–25 ng/mL to about 150 ng/mL, representing a 6- to 7-fold increase, a slightly larger fold change than for ACTH.

Indeed, corticosterone levels increase sevenfold. However, corticosterone is hydrophobic and does not circulate freely in the blood; it must be bound to a transporter to move through the aqueous plasma.
While both hormones increase significantly, corticosterone shows the highest fold increase in GB E. coli mice. That means the hormone we’re being asked about is corticosterone, not ACTH.

Next, consider the nature of corticosterone. It is a lipid-derived steroid hormone. Steroid hormones are hydrophobic and cannot circulate freely in plasma. Instead, they require carrier proteins (such as corticosteroid-binding globulin) to remain soluble in the bloodstream and be transported to target tissues.

ACTH, a peptide hormone, circulates freely in the bloodstream but does not exhibit the highest fold increase in the figure; corticosterone does. The levels of ACTH only increase by 5 times (from 50 to 250 pg/mL), thus less than corticosterone, which increases by 7 times.
According to the figure, ACTH levels only increase by 5 times. Furthermore, peptide hormones, like ACTH, are hydrophilic and do not require transport proteins; they dissolve readily in the plasma and circulate freely.

This question asks about the structural feature common to both microorganisms used in Experiment 3: Bifidobacterium infantis (a gram-positive bacterium) and Escherichia coli (a gram-negative bacterium). To answer this question, we must recall the similarities and differences between gram-positive and gram-negative bacteria.

The gram-positive Bifidobacterium infantis and the gram-negative Escherichia coli in the experiment are bacteria. So, both organisms are bacteria, but they differ in their Gram-staining characteristics due to differences in cell wall structure. Despite this, they still share fundamental prokaryotic features. All bacteria, whether gram-positive or gram-negative, possess circular DNA rather than linear chromosomes like eukaryotic cells.

Bacteria are prokaryotic organisms that lack membrane-bound organelles such as a nucleus, mitochondria, or endoplasmic reticulum. Unlike eukaryotic cells, bacterial cells carry out their cellular processes within the cytoplasm or on the plasma membrane rather than in specialized organelles.
Only gram-negative bacteria, such as Escherichia coli, have outer and inner plasma membranes. In contrast, gram-positive bacteria, such as Bifidobacterium infantis, lack an outer membrane and have a thick peptidoglycan layer surrounding their plasma membrane. Since only one of the two bacteria has a double membrane, this feature is absent in both microorganisms.
Gram-positive and Gram-negative bacteria have a single circular chromosome, which is not enclosed in a nucleus. This is a shared feature of all bacteria, making it the correct answer.
While gram-negative bacteria, such as Escherichia coli, have a thin peptidoglycan layer in their cell wall, gram-positive bacteria, such as Bifidobacterium infantis, have a much thicker peptidoglycan layer. This difference in cell wall thickness is a distinguishing factor between gram-positive and gram-negative bacteria, meaning both types do not share the feature of a thin cell wall.

This question asks about the germ layer from which the organ with high CRF levels originates. To answer this question, we must recall embryonic germ layer differentiation and which tissues and organs develop from the three primary germ layers: ectoderm, mesoderm, and endoderm.

Based on the passage, researchers observed elevated CRF levels in the hypothalamus of germ-free mice. So, from which germ layer does the hypothalamus originate?

The hypothalamus is part of the central nervous system. It originates from the ectoderm, specifically the neural tube that forms from ectodermal tissue. The ectoderm gives rise to the entire nervous system, including the brain, spinal cord, and peripheral nerves.
No brain structure originates from the endoderm. The endoderm primarily forms the epithelial lining of the gastrointestinal and respiratory tracts, along with organs such as the liver and pancreas, but it does not contribute to brain structures.
The hypothalamus derives from the ectoderm; a few brain structures, such as vessels, originate from the mesoderm. While mesodermal derivatives include the blood vessels supplying the brain, the hypothalamus is not mesoderm-derived.
The trophoderm is not one of the three germ layers but contributes to forming the placenta and extraembryonic structures.

This question asks about the method researchers most likely used to analyze the adrenal and pituitary glands in Experiment 2. To answer this question, we must understand the various molecular biology techniques used to analyze tissues and their structures.

In Experiment 2, the passage states, “Researchers observed no structural differences in the adrenal and pituitary glands between GF and SPF mice after they had been restrained.” This tells us the focus of the experiment was on observing tissue structure, not measuring gene expression or protein levels. The goal was anatomical comparison, likely involving staining and microscopy.

Immunohistochemistry (IHC) is a technique used to visualize the presence and localization of specific proteins within intact tissue sections. It combines histological analysis (preserving the structure and architecture of tissues) with antibody-based detection of molecular targets. IHC is especially valuable when you want to know how much protein is present and where in the tissue it’s being expressed—for example, which cells within a gland express a hormone.

The process starts with tissue fixation, then embedding, slicing, and mounting thin tissue sections onto microscope slides. The sections are then incubated with a primary antibody that specifically binds to the target protein. A secondary antibody, conjugated to an enzyme (such as horseradish peroxidase) or a fluorophore, is added to bind the primary antibody. Detection is then achieved through a colorimetric reaction or fluorescent signal, allowing the protein’s distribution to be visualized under a light or fluorescence microscope.

Researchers examining the structure of the adrenal and pituitary glands on prepared slides strongly suggest that immunohistochemistry (IHC) was used. Immunohistochemistry is a technique that involves staining tissue sections with antibodies that specifically bind to proteins of interest, allowing researchers to visualize the structure, organization, and localization of specific molecules within tissues.
Northern blotting detects and measures RNA expression levels, not tissue structure. It involves extracting RNA from a sample, running it on a gel, transferring it to a membrane, and probing it with a complementary RNA or DNA sequence. While it is useful for studying gene expression, it does not provide any morphological information about tissues.
Southern blotting analyzes DNA sequences. It involves extracting DNA, digesting it with restriction enzymes, running it on a gel, and then hybridizing it with a labeled probe. It helps identify specific genes or mutations in DNA but does not provide any insight into the structural organization of organs.
Western blotting detects and quantifies proteins in a homogenized sample. However, it requires tissues to be broken down (homogenized) to extract proteins, which would destroy their structural integrity. Since researchers in the experiment were examining the structure of the adrenal and pituitary glands, Western blotting would not be appropriate.

This question asks about the enzyme that is required for the production of cDNA from an RNA template.

To answer this question, we must understand the process of cDNA synthesis and the enzymes involved in nucleic acid metabolism.

When researchers want to convert an RNA molecule (such as mature mRNA) into DNA, they use a specialized enzyme called reverse transcriptase. This enzyme synthesizes a complementary DNA strand using RNA as a template, forming a cDNA-RNA hybrid. Reverse transcriptase is naturally found in retroviruses, including HIV, where it plays a role in converting viral RNA genomes into DNA that can integrate into the host genome. In the laboratory, reverse transcriptase is widely used to produce cDNA for gene expression studies, cloning, and sequencing.

Deoxyribonuclease breaks down DNA rather than synthesizing it. DNase cleaves phosphodiester bonds in DNA molecules, leading to their degradation. It is often used in experiments to remove contaminating DNA from RNA samples, but it does not play a role in the formation of cDNA.
Peptidyl Transferase functions in protein synthesis, not nucleic acid synthesis. Peptidyl transferase is an enzymatic activity of the ribosome, specifically within the large ribosomal subunit, that catalyzes the formation of peptide bonds between amino acids during translation. Since cDNA synthesis involves nucleic acids and not protein formation, peptidyl transferase is irrelevant to this process.
The reverse transcriptase enzyme synthesizes complementary DNA (cDNA) from an RNA template. This process occurs during reverse transcription, which is commonly used in molecular biology techniques such as reverse transcription-polymerase chain reaction (RT-PCR) to study gene expression. Reverse transcriptase is a DNA polymerase that reads an RNA strand and synthesizes a complementary DNA strand.
RNA Polymerase is responsible for transcribing DNA into RNA, not the reverse. RNA polymerase synthesizes RNA from a DNA template during transcription but does not convert RNA back into DNA.

This question asks about the percentage of DNA molecules containing radioactive phosphate on at least one strand after two rounds of PCR. To answer this question, we must understand the semi-conservative nature of DNA replication and how the radioactive phosphate label is inherited through multiple rounds of PCR.

PCR (polymerase chain reaction) is a method used to amplify DNA through repeated cycles of:

1. Denaturation – separating the two strands of the DNA.

2. Annealing – primers bind to target sequences.

3. Extension – DNA polymerase synthesizes new DNA strands using non-radioactive nucleotides, in our case.

The original template DNA is radioactively labeled on both strands using radioactive phosphate in this setup. However, all new DNA strands synthesized during PCR are built using non-radioactive nucleotides. That means only the original DNA strands contain radioactivity—any new DNA made during the process will be unlabeled.

In semi-conservative replication, each newly synthesized DNA double helix consists of one old strand (template) and one newly synthesized strand. Given that the original DNA template is labeled with radioactive phosphate on both strands, we can analyze how the label is passed down through two rounds of PCR.

DNA replication is semi-conservative. Each round of replication produces a DNA molecule consisting of one old DNA strand bound to a new DNA strand. Therefore, the original radioactive strands will persist through each round of replication.
Only after three rounds of PCR would a 25% retention of labeled strands occur. Each round of replication halves the proportion of labeled DNA molecules that retain a radioactive strand.
In the first round of PCR, the double-stranded DNA is denatured into two single strands, each serving as a template for synthesis of a new complementary strand. Because only the templates are radioactive and the incoming nucleotides are not, the result is two hybrid DNA molecules, each consisting of one radioactive strand (from the template) and one non-radioactive strand (newly synthesized). So after one round, you have two double-stranded molecules containing one radioactive strand.

In the second round of PCR, each of these two molecules is again denatured, and each strand—radioactive or not—serves as a template for another round of synthesis using non-radioactive nucleotides. The radioactive strands produce new non-radioactive complementary strands, resulting in two additional hybrid molecules (still containing one radioactive strand). However, the non-radioactive strands from the first round also serve as templates. They produce fully non-radioactive DNA molecules because they are non-radioactive and use non-radioactive nucleotides. Therefore, after the second round, you end up with four double-stranded DNA molecules: two hybrid molecules containing one radioactive strand, and two completely non-radioactive.

Thus, after two rounds of PCR, 2 out of 4 molecules (or 50%) contain at least one radioactive strand.

The first round of replication results in all DNA molecules being labeled on one strand, and the second round introduces additional non-radioactive strands. However, only 50% of the DNA molecules are labeled with radioactive phosphate after two rounds. As a result, not all DNA molecules will contain a labeled strand after two rounds.

This question asks about the action likely to increase FADH2 production in the citric acid cycle. To answer this question, we must understand the principles of the citric acid cycle (also known as the Krebs cycle or tricarboxylic acid cycle), specifically the step where FADH2 is produced.

The citric acid cycle is a central metabolic pathway that takes place in the mitochondrial matrix and is responsible for oxidizing acetyl-CoA to CO2, while capturing high-energy electrons in the form of NADH and FADH2. These electron carriers then feed into the electron transport chain to drive ATP synthesis via oxidative phosphorylation.

The cycle begins when acetyl-CoA (2 carbons) combines with oxaloacetate (4 carbons) to form citrate (6 carbons). Citrate is then isomerized and progressively decarboxylated, releasing two CO2 molecules and regenerating oxaloacetate. Along the way, three NAD+ molecules are reduced to NADH, one FAD is reduced to FADH2, and one GTP (or ATP) is produced by substrate-level phosphorylation per acetyl-CoA.

In the citric acid cycle, fumarase catalyzes the conversion of fumarate into malate. If fumarase is inhibited, fumarate will accumulate. Since fumarate is generated from succinate in a reaction where FAD is reduced to FADH2, an increase in fumarate levels can hinder the conversion of succinate to fumarate, ultimately reducing FADH2 production.
The conversion of succinate to fumarate results in the reduction of FAD to FADH2. If fumarate levels rise, this reaction will be suppressed, decreasing FADH2 production.
The reduction of FAD to FADH2 occurs when succinate is transformed into fumarate. A decrease in succinate levels will limit this reaction, resulting in lower FADH2 production.
FADH2 is generated when succinate is converted to fumarate, a reaction catalyzed by succinate dehydrogenase. During this process, flavin adenine dinucleotide (FAD) is reduced to FADH2, which later donates electrons to the electron transport chain, contributing to ATP production. Therefore, increasing the activity of this enzyme will lead to a higher conversion rate of succinate to fumarate and, consequently, a greater production of FADH2.

This question asks about the most direct impact of a mutation that prevents cyclin binding to Cdk1 during the cell cycle. To answer this question, we must understand the principles of cell cycle regulation and cyclin-Cdk complexes.

Checkpoints and regulatory proteins control the cell cycle, which ensures proper progression through different phases. Cyclin-dependent kinases (Cdks) are essential enzymes that drive the cell cycle forward but require binding to specific cyclins to become active. Cdk1, in particular, must bind to mitotic cyclins to initiate mitosis (M phase). If this binding is blocked, the cell cannot transition from G2 to M, leading to cell cycle arrest.

Cdk1 (cyclin-dependent kinase 1) is a key kinase that drives the cell from G2 into M phase (mitosis). It must bind to a specific cyclin, cyclin B, to form the maturation-promoting factor (MPF) complex. This complex is necessary to phosphorylate multiple targets that initiate the structural and enzymatic changes required for mitotic entry, such as chromosome condensation, nuclear envelope breakdown, and spindle formation. If a mutation prevents cyclin from binding to Cdk1, the Cdk1–cyclin B complex cannot form, and as a result, the cell fails to initiate mitosis. This leads to a cell cycle arrest at the G2/M transition, preventing the cell from entering M phase.
Entry into S phase is regulated primarily by Cdk2 and cyclins E and A, not Cdk1. This mutation does not affect S phase (DNA synthesis phase) entry.
The interaction between cyclin and Cdk1 controls the progression of G2 to M, but will not likely impact G1.
The mutation prevents exit from G2, not acceleration through it. Cells accumulate in G2 and do not move faster.

The question asks about the type of mutation which is most likely the cause of Bartter syndrome in the infant that researchers assessed. To answer this question, we must differentiate between different types of mutations—missense, nonsense, frameshift, and silent—and how they impact protein synthesis.
A frameshift mutation occurs due to insertions or deletions of nucleotides that shift the reading frame of the genetic code, often causing major structural changes in the protein or introducing premature stop codons. Since the mutation in the infant is a single amino acid substitution rather than a large structural change, a frameshift mutation is unlikely.
A missense mutation is the most likely cause of Bartter syndrome in the infant assessed because the mutation identified, A555T, indicates a single amino acid substitution in the NKCC2 cotransporter. Missense mutations occur when a single nucleotide change results in the incorporation of a different amino acid into the protein sequence. In this case, the substitution of alanine (A) with threonine (T) at position 555 likely alters the structure or function of the NKCC2 cotransporter, leading to impaired sodium and potassium transport in the kidney tubules and the resulting physiological symptoms of Bartter syndrome.
A nonsense mutation introduces a premature stop codon, leading to the loss of multiple amino acids from a protein and early termination of protein synthesis. This results in a truncated, often nonfunctional protein. The passage does not describe a premature stop codon but rather a single amino acid change, making a nonsense mutation unlikely.
A silent mutation involves a change in the nucleotide sequence that does not alter the amino acid sequence. Although silent mutations can substitute a nucleotide, they do not typically cause a change in protein function or phenotype. In this case, the mutation in the NKCC2 cotransporter alters its function, meaning the mutation is not silent.

This question asks about the process that causes a change in aldosterone secretion. To answer this question, we must understand the principles of renal physiology and electrolyte homeostasis.
The passage states that type I Bartter syndrome results from a loss-of-function mutation in the NKCC2 cotransporter, which normally reabsorbs sodium (Na+) from the kidney filtrate into the tissue fluid surrounding the tubules. Because this transporter is defective in individuals with Type I Bartter syndrome, sodium is not efficiently reabsorbed and is instead lost in the urine. This results in low plasma Na+ levels. The body responds to low plasma sodium by increasing the secretion of aldosterone, a hormone that promotes sodium reabsorption in the kidneys to help restore electrolyte balance.
A decrease in plasma sodium levels triggers an increase, rather than a decrease, in aldosterone secretion.
Elevated plasma sodium levels would result in reduced, rather than increased, aldosterone secretion.
Type I Bartter syndrome is caused by a loss-of-function mutation in the NKCC2 cotransporter, which normally facilitates sodium reabsorption from the kidney filtrate. As a result, sodium levels in the blood plasma become lower, not higher, in individuals with this condition.

This question asks about the percent probability of an offspring inheriting Type I Bartter syndrome. To answer this question, we must understand the principles of Mendelian inheritance and autosomal recessive genetic disorders.
Since both parents are carriers, there is a possibility of their child inheriting the disorder. A 0% probability would only occur if at least one parent lacked the mutated allele entirely.
Bartter syndrome Type I is inherited in an autosomal recessive manner, meaning an individual must inherit two copies of the mutated SLC12A1 allele—one from each parent—to develop the condition. If both parents are carriers, they each have one mutated allele and one normal allele. Since each parent can pass either allele to their offspring, the probability of the child inheriting two mutated alleles (and thus developing Bartter syndrome) follows the basic principles of Mendelian inheritance. Each parent has a 50% chance of passing the mutated allele and a 50% chance of passing the normal allele. The probability of the child inheriting two mutated alleles is calculated as 50% × 50% = 25%.
Although each parent has a 50% chance of passing the mutated allele, the child must inherit two copies to develop the condition. The probability of inheriting one mutated allele (carrier status) is 50%, but the probability of inheriting two mutated alleles (having the disorder) is only 25%.
Each parent carries one normal allele, meaning there is a possibility that the offspring may inherit two normal alleles instead of two mutated ones. The chance of inheriting two normal alleles (and thus being completely unaffected) is 25%, while the chance of inheriting one mutated allele (being a carrier) is 50%.

This question asks about the structure of the nephron which immediately follows the nephron region impacted by Type I Bartter syndrome. To answer this question, we must understand the anatomy of the nephron and the sequence of structures involved in filtrate processing. The nephron is the functional unit of the kidney, responsible for filtering blood and forming urine. Each nephron consists of multiple regions, including the glomerulus, proximal convoluted tubule, loop of Henle (descending and ascending limbs), distal convoluted tubule, and collecting duct.
The glomerulus is the starting point of the nephron, where blood is filtered into the renal tubule system. The ascending loop of Henle and glomerulus are separated by several nephron regions, including the proximal convoluted tubule and descending loop of Henle.
The collecting duct is located after the distal convoluted tubule. Since the DCT follows the ascending limb of the loop of Henle, the collecting duct is not the immediate next structure. Instead, filtrate from the DCT flows into the collecting duct, where water reabsorption occurs under the influence of hormones like aldosterone and antidiuretic hormone (ADH).
The passage indicates that type I Bartter syndrome primarily affects the ascending limb of the loop of Henle, where the NKCC2 cotransporter plays a role in sodium reabsorption. The nephron region that immediately follows the ascending limb of the loop of Henle is the distal convoluted tubule (DCT).
The ascending loop of Henle, which is directly affected during Type I Bartter syndrome, is separated from the proximal convoluted tubule by the descending loop of Henle. The proximal convoluted tubule (PCT) is located before the loop of Henle, not after it. The PCT plays a crucial role in reabsorbing nutrients, water, and ions from the filtrate before it reaches the loop of Henle.

This question asks about the change in blood pressure which is most likely associated with Bartter syndrome. To answer this question, we must understand the relationship between kidney function, water reabsorption, and blood pressure regulation.
Bartter syndrome causes excessive urinary output, meaning less water is reabsorbed into the bloodstream. If more water were reabsorbed, blood volume would increase, leading to higher blood pressure, which is not the case in Bartter syndrome.
While Bartter syndrome does cause decreased water reabsorption, this leads to lower, not higher, blood pressure. Reduced water retention decreases blood volume, which in turn lowers blood pressure rather than increasing it.
Increased water reabsorption would elevate blood volume and raise blood pressure, not lower it. Since Bartter syndrome actually results in decreased water reabsorption, this answer does not align with the condition’s physiological effects.
The passage states that in Bartter syndrome, there is increased urinary output. It is also noted that in Type I Bartter syndrome, a loss-of-function mutation in the SLC12A1 gene impairs the NKCC2 cotransporter, preventing sodium reabsorption. Since sodium reabsorption drives water reabsorption via osmotic gradients, reduced sodium reabsorption leads to decreased water reabsorption, increased urinary output (polyuria), and decreased levels of water in the blood. A lower blood volume results in decreased blood pressure.

This question asks about how the urine pH and potassium levels of an infant with Bartter syndrome compare to standard values. It requires interpreting urinalysis data from Table 1 to determine whether the infant’s urine is more acidic or basic and whether potassium levels are higher or lower than the standard range.
The infant’s urine pH is more basic, not acidic, so this answer is incorrect. While the potassium level is indeed higher than standard, the first part of this choice is wrong because the urine is more basic, not acidic.
From Table 1, we can see the following values for the infant’s urinalysis:

* Urine pH: 7.48 (Standard: 7.30–7.45)

* Potassium (mmol/day): 140 (Standard: 25–125)

The infant’s urine pH of 7.48 is slightly higher than the upper limit of the standard range (7.45). This indicates that the urine is more basic (alkaline) compared to the standard value. The potassium level of 140 mmol/day is much higher than the standard range of 25–125 mmol/day, meaning the infant’s urine contains more potassium than typical.

The infant’s urine has a higher potassium level, not lower. Additionally, the urine pH is more basic, not acidic. Thus, both parts of this choice are incorrect.
The infant’s urine has higher potassium levels, not lower. While the urine pH is indeed more basic, the potassium level does not align with this choice as it is higher than the standard, not lower.

This question asks about the functional group that is formed when polydatin reacts with the enzyme. To answer this question, we must understand the principles of carbohydrate chemistry, specifically the formation of glycosidic bonds and the resulting acetal functional groups.
Polydatin is described in the passage as a glycoside, meaning it forms a glycosidic bond when reacting with the enzyme. A glycosidic bond occurs when the anomeric carbon of a carbohydrate (sugar) binds covalently to another molecule via a hydroxyl (-OH) group. This reaction results in the formation of an acetal functional group. Acetals consist of a carbon atom bonded to two ether (-OR) groups and a hydrogen or another carbon-containing group. Since polydatin binds at the active site of the enzyme and forms a glycosidic bond, this means an acetal is formed.
An amide bond forms between a carboxylic acid (-COOH) and an amine (-NH2). When the reaction occurs between two amino acids, a specialized amide known as a peptide forms. However, polydatin forms a glycosidic bond, not an amide bond.
An anhydride is a high-energy bond formed between two carboxylic acid groups. ATP, as mentioned in the passage, contains these bonds within its phosphate groups, which are commonly broken to release biochemical energy. However, this type of linkage is not characteristic of a glycoside.
An ester forms when a carboxylic acid reacts with an alcohol (-OH). While carbohydrates do contain hydroxyl groups, they typically do not form ester bonds. Carbohydrates are associated with ether functional groups, but not esters.

This question asks about the enzyme that is inhibited by polydatin. To answer this question, we must understand the principles of metabolic pathways, specifically the pentose phosphate pathway (PPP) and glycolysis.
Hexokinase is the first enzyme of glycolysis, not the pentose phosphate pathway. It phosphorylates glucose to form glucose 6-phosphate, committing it to further metabolism.
The first enzyme of PPP is known as glucose 6-phosphate dehydrogenase, not glucose 6-phosphatase, which is the last enzyme in gluconeogenesis. Glucose 6-phosphatase removes the phosphate from glucose 6-phosphate to generate free glucose.
Glucose 6-phosphate dehydrogenase (G6PD) is the first enzyme in the pentose phosphate pathway (PPP), which is responsible for producing NADPH and ribose 5-phosphate, essential for biosynthetic reactions and cell growth. The passage states that polydatin inhibits the first enzyme of PPP by binding at its active site. Since G6PD catalyzes the oxidation of glucose 6-phosphate and reduces NADP+ to NADPH, it is the enzyme being inhibited by polydatin. This inhibition leads to a reduction in NADPH levels, impairing biosynthetic reactions and ultimately causing apoptosis in undifferentiated and cancer cells in a dose-dependent manner.
The first enzyme of PPP is glucose 6-phosphate dehydrogenase, not glyceralhdehyde-3-phosphate dehydrogenase (GAPDH), which is involved in glycolysis. GAPDH catalyzes the conversion of glyceraldehyde-3-phosphate into 1,3-bisphosphoglycerate while producing NADH.

This question asks about the condition inside the cells that would allow for the breakdown of the glycolytic intermediate, with the given ΔG°, to proceed. To answer this question, we must understand the principles of Le Chatelier’s principle, and cellular metabolic control mechanisms.
Enzyme concentration is a kinetic parameter in reactions. Increasing the enzyme concentration enhances the reaction rate but does not change the reaction’s thermodynamic favorability. Enzymes lower the activation energy, making reactions occur faster, but they do not alter the equilibrium position or make an unfavorable reaction spontaneous.
Activation energy determines how quickly a reaction reaches equilibrium, but it does not affect whether a reaction is thermodynamically favorable. Even if a reaction has a low activation energy, it will not proceed spontaneously unless the overall ΔG is negative, which is influenced by reactant and product concentrations.
The reaction described in the passage has a positive standard free-energy change (ΔG° = +23.8 kJ/mol), meaning that under standard conditions, it is not spontaneous. However, the actual free-energy change (ΔG) in cells depends on the concentrations of reactants and products. According to Le Chatelier’s principle, an unfavorable reaction can be driven forward if the ratio of products to reactants is kept low. This occurs when products are rapidly removed or reactants are highly concentrated, shifting the equilibrium to favor product formation.
Many unfavorable reactions in metabolism are driven by coupling to ATP hydrolysis, which has a large negative ΔG° and provides free energy to drive otherwise nonspontaneous reactions. However, the passage does not indicate that this reaction is coupled to ATP hydrolysis. Instead, it states that the reaction proceeds due to the low product-to-substrate ratio.

This question asks about the observation which best confirms the PPP-selectivity of polydatin in Warburg-related metabolism.
To answer this question, we must understand the principle of enzyme inhibition and its impact on metabolic pathways. Polydatin inhibits glucose-6-phosphate dehydrogenase (G6PD), the rate-limiting enzyme of the pentose phosphate pathway (PPP). This inhibition leads to redox imbalance, causing apoptosis in cancer cells. Overexpression of G6PD enhances resistance to apoptosis, suggesting that increased G6PD activity can counteract the effects of polydatin. Therefore, cancer cells overexpressing G6PD would exhibit more resistance to polydatin-induced apoptosis, confirming the PPP-selectivity of polydatin in Warburg-related metabolism. Since polydatin inhibits this enzyme, its effectiveness should be reduced when the enzyme is overexpressed, leading to less apoptosis. This supports the idea that polydatin acts selectively on the PPP rather than affecting other metabolic pathways directly.
This finding implies that polydatin-induced cancer cell death can take place even without the involvement of the first enzyme in the PPP. This suggests that an alternative mechanism, separate from PPP inhibition, may be responsible for the observed effect.
Because differentiated cells do not rely on Warburg-related metabolism, this result does not provide insight into polydatin’s effects on this specific metabolic process.
As mentioned in the passage, differentiated cells and tissues do not exhibit the Warburg Effect, which is characterized by increased glycolysis. Therefore, studying polydatin’s impact on these cells does not serve as a control experiment for its specificity but rather explores an entirely different research question.

This question asks about the cells that are most likely susceptible to polydatin-induced apoptosis. To answer this question, we must understand the principles of cellular metabolism and differentiation. The Warburg Effect describes how rapidly proliferating cells, such as cancer cells, favor aerobic glycolysis over oxidative phosphorylation to support increased biomass production. This metabolic shift provides glycolytic intermediates for biosynthesis and enhances the pentose phosphate pathway (PPP) to generate NADPH and ribose 5-phosphate, which are required for cell growth. Since polydatin inhibits the first enzyme of the PPP, it disrupts NADPH production and biosynthetic processes, leading to apoptosis in cells that rely on this pathway.
Cardiac tissue is composed of fully differentiated cells (such as cardiomyocytes). Therefore, this tissue would not be dependent upon metabolic pathways disrupted by polydatin, as the metabolic hallmarks of the Warburg Effect are not observed in fully differentiated tissues.
Neurons are fully differentiated cells. Therefore, they would not be dependent upon metabolic pathways disrupted by polydatin, as fully differentiated cells do not undergo this metabolic shift.
Neutrophils are fully differentiated cells of the innate immune system. The passage notes that the fully differentiated cells are excluded from this metabolic shift.
Fully differentiated cells, such as cardiomyocytes, neurons, and neutrophils, do not undergo this metabolic shift and primarily depend on oxidative phosphorylation rather than glycolysis and the PPP. As a result, they are not susceptible to polydatin-induced apoptosis.

Stem cells, however, are undifferentiated and rely on Warburg-like metabolism to sustain rapid proliferation, similar to cancer cells. They depend on the PPP for NADPH production and macromolecule synthesis, making them vulnerable to polydatin’s inhibitory effects. Stem cells must sustain rapid cellular expansion to replenish platelets or red blood cells, which are in constant demand, and also promote dynamic immune cell expansion upon infection. Because they share key metabolic features with cancer cells, polydatin could significantly impact them.

This question asks about the type of inhibition that is exerted by polydatin. To answer this question, we must understand the principles of enzyme inhibition and inhibitor binding mechanisms. Enzyme inhibitors can be classified as reversible or irreversible based on how they interact with their target enzymes.
Competitive inhibition occurs when an inhibitor resembles the enzyme’s substrate and binds to the active site, preventing substrate binding. However, competitive inhibitors do not form covalent bonds.
Non-competitive inhibition refers to an inhibitor binding to an allosteric (non-active) site on the enzyme, reducing its activity without preventing substrate binding. This inhibition is also reversible, which contradicts the passage.
Mixed inhibition is a form of reversible inhibition where the enzyme–inhibitor complex is in equilibrium with the free enzyme.
Reversible inhibitors bind non-covalently and can dissociate from the enzyme, while irreversible inhibitors form covalent bonds that permanently inactivate the enzyme.

The passage states that polydatin forms a glycosidic bond at the active site of the first enzyme in the PPP, which suggests irreversible inhibition, as covalent modifications typically lead to permanent enzyme inactivation.

This question asks about the graph which most likely depicts the expected results concerning the NADP+/NADPH ratios. To answer this question, we must understand the role of NADP+/NADPH balance in the pentose phosphate pathway (PPP) and how polydatin, as an inhibitor of the first enzyme in the PPP, impacts this ratio.
The PPP is required for generating NADPH, which is required for biosynthetic reactions and redox balance. The first enzyme in this pathway oxidizes a glycolytic intermediate and reduces NADP+ to NADPH. By inhibiting this enzyme, polydatin prevents the conversion of NADP+ to NADPH, leading to a progressive accumulation of NADP+ and a decline in NADPH levels over time. This results in an increased NADP+/NADPH ratio, which is best represented by Graph A.
Graph B suggests that NADPH is accumulating, meaning the reduced form of the coenzyme is increasing over time. This contradicts the expected effect of polydatin, which inhibits the first step in the PPP that produces NADPH from NADP+. Since NADPH is continuously consumed in biosynthetic reactions, its levels should not increase when its main source (PPP) is inhibited.
Graph C indicates no change in the NADP+/NADPH ratio when polydatin is administered. This refutes, not supports, the conclusions from the current study. As polydatin inhibits the PPP, which produces NADPH from NADP+, these ratios would be expected to change.
Graph D is incorrect because it shows a fluctuating pattern in the NADP+/NADPH ratio, implying that polydatin’s effects are transient or reversible. While it’s possible for metabolization or degradation of polydatin to alter its activity over time, the passage does not suggest such a mechanism. The oscillating nature of the data is an over-interpretation and does not align with the expected consistent increase in the NADP+/NADPH ratio caused by PPP inhibition.

This graph demonstrates fluctuations in the levels of the oxidized and reduced forms of the coenzyme over time. Such variations could potentially occur if polydatin were broken down and lost its effectiveness within the cells. However, this is an over-interpretation of the results. Additionally, the recurrence of polydatin’s effects at the final time point raises further questions about this interpretation.

This question asks about the structures that are most likely found in cholesterol. To answer this question, we must understand the principles of the structural characteristics of different biomolecules.
Benzene is an aromatic ring structure with alternating single and double bonds, which is not found in cholesterol. While cholesterol has hydrocarbon rings, these rings are not aromatic because they do not contain conjugated double bonds in the same way benzene does. Instead, cholesterol consists of saturated and partially unsaturated rings that are characteristic of steroids.
Cholesterol is classified as a steroid, which means it belongs to a group of lipids that share a characteristic four-ring hydrocarbon structure. Specifically, it consists of three six-membered rings and one five-membered ring, all fused together in a rigid arrangement. This core structure is known as the steroid nucleus and is found in all steroid-based molecules, including hormones like testosterone and estrogen. In addition to these rings, cholesterol has a hydroxyl (-OH) group at one end and a hydrocarbon tail at the other, which contribute to its amphipathic nature, allowing it to interact with both hydrophobic and hydrophilic environments in biological membranes.
Monosaccharides are the building blocks of carbohydrates, such as glucose and fructose. These sugar molecules contain oxygen atoms and hydroxyl groups, making them hydrophilic. Cholesterol, on the other hand, is a lipid, meaning it is mostly hydrophobic and does not contain monosaccharide rings.
Amino acids are the building blocks of proteins, and some amino acids, such as phenylalanine and tryptophan, contain aromatic rings. However, cholesterol is not a protein or a peptide; it is a lipid molecule. Unlike amino acids, cholesterol does not contain amino (-NH2) or carboxyl (-COOH) groups.

This question asks about the neuronal structure that is most likely to generate a postsynaptic potential in direct response to neurotransmitters. To answer this question, we must understand the principles of synaptic transmission and neuronal signaling.
Dendrites are the primary structures that receive signals from other neurons via neurotransmitters. These signals bind to receptors on the dendritic membrane, many of which are ligand-gated ion channels, leading to the generation of postsynaptic potentials (PSPs). These PSPs can be either excitatory (EPSPs) or inhibitory (IPSPs), and they determine whether the neuron will reach the threshold to generate an action potential.
The axon hillock is responsible for integrating all incoming PSPs and determining whether an action potential will be initiated. However, it does not generate postsynaptic potentials itself. Instead, it acts as the trigger zone where a neuron decides whether to fire.
The axon terminal is where neurotransmitters are released into the synaptic cleft. This structure is involved in transmitting signals to the next neuron but does not generate postsynaptic potentials.
The Node of Ranvier is a gap between segments of the myelin sheath along an axon. These nodes are critical for saltatory conduction, allowing the action potential to “jump” between them for faster transmission. However, they do not generate postsynaptic potentials.

This question asks about the event that is associated with the first four weeks following fertilization. To answer this question, we must understand the principles of early pregnancy physiology and hormonal regulation.
The corpus albicans forms only if fertilization does not occur. If no pregnancy happens, the corpus luteum degenerates into a corpus albicans, a non-functional scar-like structure. However, if fertilization occurs, the corpus luteum remains functional rather than degenerating.
The oocyte completes meiosis I before ovulation, not after fertilization. During the ovarian cycle, a primary oocyte completes meiosis I just before ovulation, forming a secondary oocyte and a polar body. After sperm entry, the secondary oocyte completes meiosis II, not meiosis I.
After fertilization, the corpus luteum, which forms from the remnants of the ovarian follicle after ovulation, is maintained to continue producing progesterone. Progesterone is essential for supporting the early stages of pregnancy by maintaining the uterine lining and preventing menstruation. The human chorionic gonadotropin (hCG) hormone, secreted by the developing embryo, signals the corpus luteum to persist until the placenta takes over progesterone production around 12 weeks of gestation.
Progesterone secretion decreases only if pregnancy does not occur. In the first four weeks following fertilization, progesterone levels increase, as it is essential for pregnancy maintenance. A drop in progesterone would lead to the shedding of the uterine lining, which does not happen in a successful pregnancy.

This question asks about the manipulation the researchers potentially performed to allow the Compound A to enter the cells. To answer this question, we must understand the mechanisms by which compounds enter cells, focusing on the role of membrane transporters in facilitating the uptake of substances that cannot freely cross the lipid bilayer.
Exocytosis is the process by which cells expel materials to the extracellular space through vesicular transport. Activating exocytosis would promote the release of intracellular contents but would not facilitate the entry of extracellular compounds like Compound A into the cell.
Increasing extracellular osmolarity typically causes water to move out of cells, leading to cell shrinkage. This change will not allow a cell membrane-impermeable compound to become membrane-permeable.
Reducing the concentration of Compound A outside the cell would decrease its concentration gradient, making passive diffusion into the cell even less likely. This manipulation would not promote the uptake of Compound A.
In the given question, Compound A is initially unable to enter the cells, indicating it cannot diffuse passively through the cell membrane. However, after an experimental manipulation, Compound A is detected inside the cells.

Membrane transporters are proteins that facilitate the movement of specific molecules across the cell membrane, often against their concentration gradients. By activating these transporters, Compound A can be transported into the cell despite its inability to diffuse passively.

This question asks about the type of interaction that can exclusively link residues 303 and 354 in wild-type Aldolase B (ALB), as shown in Table 1. To determine the type of interaction that can exclusively link residues 303 and 354 in wild-type Aldolase B (ALB), we must analyze the properties of the amino acids at these positions.
According to Table 1, residue 303 in WT ALB is arginine (R), a positively charged amino acid, while residue 354 is glutamate (E), a negatively charged amino acid. The electrostatic attraction between these oppositely charged residues forms a salt bridge.
Hydrogen bonding typically involves hydroxyl (-OH), amide (-CONH2), or carbonyl (C=O) groups, which are found in amino acids like serine, threonine. While arginine and glutamate can participate in hydrogen bonding via their side chains, their primary interaction in this case is the stronger electrostatic attraction of the salt bridge rather than weaker hydrogen bonds.
Dipole–dipole interactions occur between polar but uncharged amino acids such as asparagine and glutamine, which contain electronegative atoms that create dipoles. Since arginine and glutamate are fully charged, their interaction is stronger and classified as a salt bridge, rather than a dipole–dipole force.
Hydrophobic interactions occur between nonpolar amino acids like alanine and valine, which tend to cluster together to avoid water. Since both arginine and glutamate are hydrophilic due to their charged nature, they do not form hydrophobic interactions.

This question asks about the most likely effect of ALB on the values of ΔG° and Keq for F1P cleavage. To answer this question, we must understand how enzymes affect chemical reactions. The passage indicates that Aldolase B (ALB) catalyzes the reversible cleavage of fructose-1-phosphate (F1P) into dihydroxyacetone phosphate (DHAP) and glyceraldehyde, which is later phosphorylated to glyceraldehyde-3-phosphate (G3P).
Enzymes do not change the thermodynamic favorability of a reaction, they only influence reaction speed. Neither ΔG° nor Keq of reactions are influenced by enzymes which only speed up the reaction rates. If ΔG° were to decrease, it would mean the reaction has become more favorable, which would alter the equilibrium constant (Keq).
Enzymes function to lower the activation energy of reactions, thereby increasing the reaction rates, but they do not change in which direction reactions occur. ALB does not alter the equilibrium position or change the standard free energy difference between reactants and products. If ALB caused ΔG° to increase, it would make the reaction less favorable, which is not how enzymes work.
The thermodynamics of a reaction are determined by ΔG° (standard free energy change) and Keq (equilibrium constant), which describe the favorability and extent of the reaction at equilibrium. Enzymes function as catalysts, meaning they increase reaction rates by lowering the activation energy (Ea), but they do not alter the thermodynamic properties of a reaction, such as its direction or its equilibrium. Enzymes only affect the kinetic properties as they speed up the rate of reactions. Since ΔG° and Keq are determined solely by the difference in energy between reactants and products, and not by the pathway or speed of the reaction, ALB does not affect their values.
ΔG° and Keq are thermodynamic properties which remain constant regardless of enzymatic activity. Increasing Keq would mean shifting the equilibrium in favor of the products, which is determined by the intrinsic energy differences between reactants and products, not by the presence of an enzyme.

This question asks about the hexose which is cleaved by ALB when phosphorylated. To answer this question, we must know the structure of some carbohydrates.
The passage states that ALB cleaves fructose. The structure of A is that of fructose.
This is the structure of sorbose, which is also a ketohexose.
This is the structure of galactose, which is an aldohexose, not fructose, which is a ketohexose.
This option shows the structure of glucose, an aldohexose, not fructose.

This question asks about the percentage of the population which is predicted to be heterozygous for the HFI-causing genotype. To determine the percentage of the population that is heterozygous for the hereditary fructose intolerance (HFI)-causing genotype, we must use the Hardy–Weinberg equilibrium equation, which states:

p2+2pq+q2 = 1

where:

* p2 represents the frequency of homozygous dominant individuals (unaffected).
* 2pq represents the frequency of heterozygous individuals (carriers).
* q2 represents the frequency of homozygous recessive individuals (affected by HFI).

This option is only half of the actual heterozygous population for the HFI-causing genotype. This likely results from mistakenly calculating pq instead of 2pq.
From the passage, we know that HFI affects 1 in 40,000 individuals, meaning:

q2 = 1/40,000 = 0.000025

To find q:

q = √0.000025 = 0.005

Since p+q=1, we can find p:

p = 1−0.005 = 0.995

The frequency of heterozygous carriers is given by:

2pq = 2(0.995)(0.005) = 0.00995 ≈ 0.01

This means that 1% of the population is heterozygous for HFI, making option B the correct answer.

This option assumes q = 0.01 instead of 0.005, leading to an overestimation of the heterozygous frequency.
This option is 2.5 times higher than the actual heterozygous frequency of the heterozygous genotype for HFI, which suggests a miscalculation in estimating q or an error in the application of the Hardy–Weinberg equation.

This question asks about two structural levels of ALB which were addressed in the passage. To answer this question, we must understand the principles of protein structure and organization.

Proteins have four levels of structure:

1. Primary structure – the linear sequence of amino acids in a polypeptide chain.
2. Secondary structure – local folding patterns such as alpha-helices and beta-sheets, stabilized by hydrogen bonds.
3. Tertiary structure – the overall three-dimensional shape of a single polypeptide, determined by interactions such as hydrogen bonding, hydrophobic interactions, disulfide bonds, and ionic interactions.
4. Quaternary structure – the arrangement of multiple polypeptide subunits into a functional protein complex.

While the passage discusses the primary structure by mentioning the amino acid sequence, it does not provide any details about the tertiary structure. The tertiary structure involves the three-dimensional folding of a single polypeptide chain due to interactions between side chains, but the passage does not discuss this aspect.
The passage mentions both the primary and quaternary structural levels of Aldolase B (ALB). The primary structure refers to the specific sequence of amino acids in a protein, and the passage states that each ALB subunit consists of 364 amino acids, which is a direct reference to its primary structure. The quaternary structure pertains to how multiple polypeptide subunits are assembled into a functional protein complex, and the passage clearly states that ALB is composed of four identical subunits, indicating its quaternary structure.
The passage does not mention secondary structure, which consists of alpha helices and beta sheets, nor does it describe tertiary structure, which involves the overall 3D shape of a single subunit. There is no discussion of how the polypeptide folds or the interactions between secondary structural elements.
Although the passage discusses quaternary structure (stating that ALB has four identical subunits), it does not mention secondary structure. The secondary structure refers to the presence of alpha helices and beta sheets, which are formed through hydrogen bonding, but the passage does not provide any information on these structural elements.

This question asks about the approximate osmotic pressure of the salt solution used for cell lysis at a temperature of 298 K. To answer this question, we must understand the principles of osmotic pressure.
This option is only a quarter of the actual osmotic pressure as 2(0.5 M)(0.0821)(298) = 24 atm, not 6 atm. It suggests an incorrect assumption where either the molarity or the van ‘t Hoff factor was miscalculated, likely assuming i=0.5 instead of 2.
This option is half of the correct value as it fails to account that KCl separates into two ions. This error likely arises from failing to account for the dissociation of KCl, mistakenly assuming i=1 instead of 2.
This option is incorrect as 2(0.5 M)(0.0821)(298) = 24 atm, rather than 18 atm.
Osmotic pressure (Π) is a colligative property, meaning it depends on the number of dissolved particles rather than their identity. The equation used to calculate osmotic pressure is:

Π = iMRT

where:

* i is the van ‘t Hoff factor, which accounts for the number of particles into which the solute dissociates. Since KCl dissociates into two ions (K+ and Cl–), i=2.
* M is the molarity of the solution, which is 0.5 M.
* R is the gas constant, given as 0.0821 atm·L/(mol·K).
* T is the temperature in Kelvin, given as 298 K.

Substituting these values into the equation:

Π = (2)(0.5M)(0.0821 atm·L/(mol·K))(298 K)
Π = (1)(0.0821)(298)
Π = 24.5 ≈ 24 atm

This question asks about the ALB variant that has the lowest enzyme efficiency. To determine which ALB variant has the lowest enzyme efficiency, we must understand the concept of catalytic efficiency, which is given by the ratio:

Catalytic Efficiency = kcat/KM

where:

* kcat (turnover number) represents how many substrate molecules an enzyme can convert to product per second.
* KM (Michaelis constant) represents the substrate concentration at which the enzyme reaches half of its maximum velocity; a higher KM indicates lower substrate affinity.
* A lower catalytic efficiency means the enzyme is less effective at converting substrate into product.

The catalytic efficiency (kcat/KM) of this variant is about 0.07, seven times higher than that of R303Q. While this mutation reduces efficiency compared to WT, it is not the lowest.
Catalytic efficiency for this variant is 0.17/1.8 ≈ 0.1, about 10 times higher than that of R303Q at 0.01. This means L256P retains more activity than R303Q.
The catalytic efficiency for this variant is ~0.03, which is about 3-fold higher than that of R303Q at ~0.01. Although it significantly reduces enzyme activity, it is still more efficient than R303Q.
Using the data from Table 1, we calculate catalytic efficiencies for each variant:

* Wild-type (WT):
0.98/2.2 ≈ 0.445

* E354A:
0.35/5.3 ≈ 0.066

* L256P:
0.17/1.8 ≈ 0.094

* N334K:
0.44/14.5 ≈ 0.030

* R303Q:
0.52/47.3 ≈ 0.011

Among these values, R303Q has the lowest catalytic efficiency (~0.011), making it the least efficient variant. This is because its KM value is extremely high (47.3 μM), indicating very poor substrate binding, and its turnover number is relatively low (0.52 s-1).

This question asks about the description which best applies to the nucleotide that activates GPR17. To answer this question, we must understand the differences between DNA and RNA and the structural classification of nucleotides.
Uracil is not a purine; it is a pyrimidine. The purine bases found in DNA are adenine (A) and guanine (G), which are larger, double-ring structures.
While uracil is indeed found in RNA, it is not a purine. Purines, such as adenine (A) and guanine (G), have a double-ring structure, whereas uracil is a pyrimidine with a single-ring structure.
Uracil is not a normal component of DNA. Instead, DNA contains thymine (T), cytosine (C), adenine (A), and guanine (G) as its nucleotide bases. Uracil is primarily found in RNA, replacing thymine in complementary base pairing. Therefore, although uracil is a pyrimidine, it is not a component of DNA.
Nucleotides are the building blocks of nucleic acids (DNA and RNA) and are classified into purines and pyrimidines. Purines, which have a double-ring structure, include adenine (A) and guanine (G), while pyrimidines, which have a single-ring structure, include cytosine (C), thymine (T), and uracil (U). DNA contains adenine, guanine, cytosine, and thymine, while RNA contains adenine, guanine, cytosine, and uracil (where uracil replaces thymine).

The passage states that GPR17 is activated by uracil. Uracil serves as an agonist for GPR17. Uracil is a component of RNA. Uracil, like cytosine and thymine, belongs to the pyrimidine group.

This question asks about the most likely impact of GPR17 activation on ATP synthesis. To answer this question, we must understand the principles of cellular respiration and energy metabolism, particularly the roles of glycolysis, the citric acid cycle (Krebs cycle), and oxidative phosphorylation in ATP production.
Activation of GPR17 inhibits pyruvate dehydrogenase, blocking the conversion of pyruvate into acetyl-CoA. Consequently, pyruvate is instead converted into lactate. However, this process yields less ATP compared to the pathway in which pyruvate is transformed into acetyl-CoA.
GPR17 activation inhibits pyruvate dehydrogenase, which directly reduces acetyl-CoA production. Since acetyl-CoA is essential for the citric acid cycle and subsequent ATP synthesis through oxidative phosphorylation, a reduction in acetyl-CoA would lead to decreased ATP production rather than an increase.
The passage indicates that GPR17 activation inhibits pyruvate dehydrogenase. This enzyme is responsible for converting pyruvate into acetyl-CoA. Acetyl-CoA enters the citric acid cycle (Krebs cycle), leading to the production of electron carriers (NADH and FADH2) that drive oxidative phosphorylation in the mitochondria.

By inhibiting pyruvate dehydrogenase, less acetyl-CoA is produced, and consequently, oxidative phosphorylation is reduced, leading to a decrease in ATP synthesis. Instead of being converted to acetyl-CoA, pyruvate is redirected to lactate production, which generates significantly less ATP compared to oxidative phosphorylation. Therefore, GPR17 activation will cause ATP synthesis to decrease.

GPR17 activation inhibits the conversion of pyruvate to acetyl-CoA, leading to the redirection of pyruvate toward lactate production. This process is facilitated by the enzyme lactate dehydrogenase, resulting in increased lactate dehydrogenase activity upon GPR17 activation.

This question asks about the cell type that is most likely to give rise to a glioblastoma. To answer this question, we must understand the principles of cellular origin and differentiation in the nervous system.
The brain is composed of two major cell types: neurons, which are responsible for transmitting electrical and chemical signals, and glial cells, which provide structural, metabolic, and functional support. Glioblastomas arise from glial cells, specifically astrocytes. Astrocytes play a role in maintaining the blood-brain barrier, regulating neurotransmitter levels, and responding to injury. Since glioblastomas originate from glial cells, astrocytes are the most likely cell type to give rise to glioblastoma.
Fibroblasts are a type of connective tissue cell found throughout the body, primarily responsible for producing extracellular matrix and collagen. Unlike glial cells, fibroblasts do not contribute to the structure or function of the nervous system. Since glioblastomas arise from glial cells, not connective tissue cells, fibroblasts are not the source of glioblastoma.
Melanocytes are pigment-producing cells located in the skin and are responsible for melanin production, which gives skin its color. Melanocytes are not a type of glial cell, and their function is unrelated to the nervous system. Since glioblastomas develop from glial cells, melanocytes cannot be their origin.
Neurons are the primary signaling cells of the nervous system responsible for transmitting electrical and chemical signals. However, neurons are distinct from glial cells, which provide structural and functional support to neurons. Glioblastomas originate from glial cells rather than neurons, making neurons an unlikely source of this type of brain cancer.

The question asks about the protein or protein complex which is negatively correlated with tumor progression in the brain when activated. To answer this question, we must understand the principles of tumor suppressor regulation. This involves recognizing how proteins and complexes influence tumor progression, particularly the roles of oncogenes, tumor suppressors, and regulatory pathways.
The passage explains that RNF2 promotes tumorigenesis and is a part of the PRC1 complex, meaning PRC1 also plays a role in tumor progression. PRC1 functions by inhibiting the expression of KLF9, a known tumor suppressor. Since tumor suppressors work to prevent cancer growth, activating KLF9 would reduce tumor progression. This means that higher KLF9 expression is associated with lower tumor growth, demonstrating a negative correlation between KLF9 activation and tumor progression.
The passage states that NF-κB activates RNF2, and RNF2 is known to promote tumorigenesis. Since RNF2 contributes to tumor progression, activation of NF-κB leads to an increase in RNF2 activity, which in turn promotes, rather than inhibits, tumor growth. This means NF-κB is positively correlated with tumor progression, not negatively.
PRC1 is a complex that includes RNF2, and the passage clearly states that RNF2 promotes tumorigenesis. Since PRC1 inhibits KLF9, a tumor suppressor, its activation would contribute to tumor growth. If PRC1 promotes tumorigenesis, it must be positively correlated with tumor progression.
The passage states that RNF2 promotes tumorigenesis. A protein that promotes tumor formation is expected to be positively correlated with tumor progression rather than negatively correlated. If RNF2 were activated, tumor progression would increase.

This question asks about the most likely role of GPR17 in the progression of glioblastoma. To answer this question, we must understand the principles of GPCR signaling, cAMP regulation, and tumor progression.
Figure 1 demonstrates that activating GPR17 with MDL results in a reduction in tumor volume, meaning it inhibits rather than stimulates glioblastoma progression. This is because treatment with a GPR17 agonist leads to lower tumor volume compared to saline-treated cells. Additionally, because GPR17 is Gi-coupled, it inhibits adenylyl cyclase and lowers cAMP levels rather than increasing them.
While it is true that GPR17 activation decreases cAMP levels, Figure 1 shows that GPR17 activation results in a decrease in tumor volume, meaning it inhibits rather than stimulates glioblastoma progression.
Figure 1 shows that GPR17 activation results in a decrease in tumor volume, suggesting that glioblastoma progression is inhibited. However, because GPR17 is a Gi-coupled receptor, its activation leads to a reduction in cAMP levels.
G protein-coupled receptors (GPCRs) regulate various cellular functions by modulating intracellular signaling pathways. GPR17 is a Gi-coupled receptor, meaning its activation inhibits adenylyl cyclase, leading to a decrease in cAMP levels. Figure 1 demonstrates that treatment with MDL, a GPR17 agonist, results in lower tumor volume compared to saline-treated cells, indicating that GPR17 activation inhibits glioblastoma progression rather than stimulating it. Since GPR17 is Gi-coupled, its activation leads to reduced cAMP levels.

This question asks about the most direct consequence of GPR17 activation within the nervous system. To answer this question, we must understand the principles of oligodendrocyte differentiation, myelination, and action potential conduction. Oligodendrocytes are responsible for producing myelin, which insulates axons and increases the velocity of action potentials. GPR17 activation inhibits oligodendrocyte differentiation, leading to reduced myelin formation. Since myelin is crucial for rapid electrical signal transmission along neurons, its inhibition results in decreased action potential velocity. Understanding these concepts allows us to determine that GPR17 activation slows nerve conduction by reducing myelination, making decreased action potential velocity the correct answer.
GPR17 activation inhibits myelination. Since oligodendrocytes are responsible for forming myelin, their suppression reduces rather than increases myelin production.
Synaptic transmission primarily depends on neurotransmitter release and receptor interactions at synapses, which are distinct from the role of myelin in axonal insulation. GPR17 controls oligodendrocyte differentiation and subsequent myelination. While myelin affects signal conduction and the insulation of axons, it does not directly influence synaptic activity.
GPR17 activation inhibits oligodendrocyte differentiation, which is essential for myelin formation. Oligodendrocytes produce myelin, a substance that insulates axons and increases the speed of action potential conduction. Since GPR17 suppresses oligodendrocyte maturation, this leads to reduced myelination, which in turn results in decreased action potential velocity, making C the correct answer. Myelin is critical for the rapid transmission of electrical signals along neurons, so its inhibition slows down nerve signal conduction.
Neurotransmitter synthesis occurs in neurons, whereas GPR17 primarily affects oligodendrocytes, which is required for myelin formation. Myelin formation is not directly involved in neurotransmitter production.

This question asks about the concentration of CO2(aq) in blood serum from breathing atmospheric air containing 6% CO2. To determine the concentration of CO2 in blood serum, we use Henry’s Law, which states that the concentration of a dissolved gas is directly proportional to its partial pressure in the gas phase. Mathematically, this is expressed as:

[CO2] = P(CO2) / kH

where:

* P(CO2) is the partial pressure of CO2 in the atmosphere, given as 6% of atmospheric pressure, or 0.06 atm
* kH is Henry’s law constant for CO2, given as 30 L·atm·mol-1

Plugging in the values:

[CO2] = P(CO2)/kH = 0.06 atm / 30 L·atm·mol-1 = 2.0 × 10-3 mol/L = 2.0 mM

The question assumes an atmosphere containing 6% CO2. Therefore, 0.06 atm/30 L•atm•mol–1 = 2 mM, rather than 3.0 mM.
According to Henry’s Law, the solubility of a gas is directly proportional to its partial pressure. In this case, the partial pressure of CO2 is 6% of atmospheric pressure, or 0.06 atm. Substituting the values into Henry’s Law equation:

0.06 atm / 30 L·atm·mol-1 = 2.0 × 10-3 mol/L = 2.0 mM

This option likely comes from misplacing the variables in the Henry’s Law equation. If one incorrectly reverses the position of kH and P(CO2) in the equation, they might get an incorrect answer, which does not match the actual calculation.

This question asks about the chemical formula of a natural fatty acid that most increases the fluidity of the membrane bilayer structure. To determine which fatty acid most increases membrane fluidity, we must consider the effects of saturation and chain length on the lipid bilayer. Unsaturated fatty acids, particularly monounsaturated and polyunsaturated ones, increase membrane fluidity by introducing kinks in their hydrocarbon chains, which prevent tight packing of phospholipids. In contrast, saturated fatty acids decrease fluidity because their straight chains allow for closer packing, leading to a more rigid membrane. Shorter chain fatty acids also increase fluidity by reducing van der Waals interactions between lipid molecules.
The chemical formula of lauric acid indicates that it is a saturated fatty acid, based on the ratio of hydrogen to carbon atoms. Higher concentrations of saturated lipids in the lipid bilayer tend to reduce membrane fluidity.
The chemical formula of myristic acid reveals that it is a saturated fatty acid, as indicated by the ratio of hydrogen to carbon atoms. In the lipid bilayer, saturated fatty acids contribute to increased membrane rigidity.
The chemical formula in choice C is of palmitoleic acid. As the ratio of hydrogen to carbon atoms shows, it is a monounsaturated fatty acid. The presence of a double bond in this molecule disrupts the orderly packing of lipids in the bilayer, increasing membrane fluidity. Since membrane fluidity is enhanced by the presence of unsaturated fatty acids within a lipid bilayer, palmitoleic acid contributes to greater flexibility and permeability of the membrane.
The chemical formula of stearic acid indicates that it is a saturated fatty acid, based on its hydrogen-to-carbon ratio. Within membrane bilayers, saturated fatty acids reduce membrane fluidity.

This question asks about the expression that gives the ratio of GADP to DHAP at equilibrium when the standard free energy change for the conversion of dihydroxyacetone phosphate (DHAP) to glyceraldehyde 3-phosphate (GADP) is estimated to be +5 kJ/mol.
To determine the ratio of glyceraldehyde 3-phosphate (GADP) to dihydroxyacetone phosphate (DHAP) at equilibrium, we use the standard Gibbs free energy equation:

ΔG° = -RT ln K

where:

* ΔG° is the standard free energy change, given as +5 kJ/mol (or 5000 J/mol, since 1kJ=1000J),
* R is the universal gas constant (assumed as 8.314 J/(mol·K), but we are given RT=2500 J/mol directly),
* T is the temperature in Kelvin (typically 298 K in biological conditions),
* K is the equilibrium constant, which is defined as:

K = [GADP] / [DHAP]

Rearranging the equation for K:

K = e-ΔG°/RT

Substituting the given values:

K = e-5000/2500 = e-2

This answer arises from an incorrect manipulation of the equation. Instead of using -ΔG°/RT, it mistakenly uses RT/-ΔG°, which does not follow from the proper rearrangement of the Gibbs free energy equation.
This choice incorrectly assumes that ΔG° = -5 instead of +5, leading to an incorrect sign in the exponent. Additionally, it uses RT/-ΔG° rather than -ΔG°/RT, leading to further errors.
This answer incorrectly assumes ΔG° = -5 instead of +5, resulting in the exponent being +2 instead of -2. This directly contradicts the correct mathematical formulation of the equation.

This question asks about the enzyme which is active in both the gluconeogenesis and glycogenolysis pathways. To answer this question, we must understand the roles of different enzymes in gluconeogenesis and glycogenolysis. These pathways are essential for maintaining blood glucose levels, with gluconeogenesis generating glucose from non-carbohydrate sources and glycogenolysis breaking down stored glycogen to release glucose.
Glucose-6-phosphate dehydrogenase is not involved in either gluconeogenesis or glycogenolysis. Instead, it is the first enzyme in the pentose phosphate pathway (PPP), where it catalyzes the oxidation of glucose-6-phosphate to 6-phosphogluconolactone, generating NADPH, which is important for biosynthetic reactions and oxidative stress defense.
Glucose 6-phosphatase catalyzes the final step of both gluconeogenesis and glycogenolysis. In gluconeogenesis, it converts glucose-6-phosphate into free glucose, which can then be released into the bloodstream. In glycogenolysis, after glycogen is broken down into glucose-1-phosphate and subsequently converted into glucose-6-phosphate by phosphoglucomutase, glucose-6-phosphatase removes the phosphate group, allowing free glucose to exit the liver and maintain blood sugar levels.
Phosphoglucomutase is an enzyme active in glycogenolysis, where it converts glucose-1-phosphate to glucose-6-phosphate, which can then either enter glycolysis for energy production or be converted into free glucose by glucose-6-phosphatase. However, phosphoglucomutase is not involved in gluconeogenesis.
Hexokinase is active in glycolysis, not in gluconeogenesis or glycogenolysis. It catalyzes the phosphorylation of glucose to glucose-6-phosphate, effectively trapping glucose inside the cell for energy production. Since gluconeogenesis is essentially the reverse of glycolysis, hexokinase is not part of that pathway, and glycogenolysis bypasses the need for hexokinase entirely.

This question asks about the primary function of the structure affected during PDAC. To answer this question, we must understand the structure and the role of the pancreatic duct in the exocrine function of the pancreas. The pancreas has both exocrine and endocrine functions, with the exocrine system responsible for producing and transporting digestive enzymes via the pancreatic duct to aid in digestion.
Production of bile is carried out by the liver, not the pancreas. The liver produces bile, which is then stored in the gallbladder and released into the small intestine to aid in the digestion and absorption of fats.
Nutrient absorption primarily occurs in the small intestine, particularly in the duodenum and jejunum, through specialized epithelial cells. The pancreatic duct does not play a role in absorbing nutrients; rather, it delivers digestive enzymes that facilitate digestion.
PDAC primarily affects the pancreatic duct, which is responsible for transporting digestive enzymes from the pancreas to the duodenum. The pancreas produces enzymes such as pancreatic amylase, which breaks down carbohydrates, and pancreatic lipase, which aids in fat digestion. These enzymes are secreted by exocrine cells and then transported through the pancreatic duct into the small intestine, where they assist in the breakdown and absorption of nutrients. Since PDAC directly impacts the pancreatic duct, the primary function affected by this cancer is the transport of digestive enzymes.
While the pancreas does produce insulin and glucagon, these hormones are synthesized by the pancreatic islets (islets of Langerhans), which are involved in endocrine function. The pancreatic duct, however, is part of the exocrine system, responsible for transporting digestive enzymes.

This question asks about the molecule that is transported by Glut5. To answer this question, we must understand the principle of membrane transport and substrate specificity of transport proteins. Different transporters selectively move specific molecules across the cell membrane based on their structure and chemical properties. Glut5 is a fructose-specific transporter, meaning it facilitates the uptake of fructose but not other sugars like glucose, sucrose, or lactose.
In addition, knowledge of carbohydrate structures is also required in order to recognize the correct molecule. Glut5 is a fructose transporter, and the indicated structure represents fructose. Glut5 is a facilitated diffusion transporter that specifically facilitates the uptake of fructose into cells. In the study, researchers found increased expression of Glut5 in PDAC cells, suggesting that these cancer cells have an enhanced ability to take up fructose, which may contribute to their growth and survival.
The structure shown represents glucose, not fructose. While both fructose and glucose are monosaccharides, they differ in structure: glucose is an aldohexose (contains an aldehyde group), whereas fructose is a ketohexose (contains a ketone group). Importantly, Glut5 does not transport glucose.
The molecule shown is sucrose, a disaccharide composed of glucose and fructose. While sucrose contains fructose, it cannot be directly transported by Glut5. Instead, sucrose must first be broken down into its monosaccharide components (glucose and fructose) by the enzyme sucrase in the intestine before fructose can be transported by Glut5.
The structure shown is lactose, another disaccharide, composed of glucose and galactose. Since lactose does not contain fructose, it is irrelevant to Glut5 function. Instead, lactose is broken down by the enzyme lactase into glucose and galactose, and these sugars are transported into cells through different glucose transporters.

This question asks about the number of segments of the Glut5 primary structure that correspond to a cytoplasmic protein region. To answer this question, we must understand how transmembrane proteins are structured within the lipid bilayer. Integral membrane proteins, such as Glut5, contain hydrophobic transmembrane domains that span the membrane, alternating with hydrophilic regions that are either extracellular or cytoplasmic. The number of cytoplasmic regions in a membrane protein depends on the number of transmembrane helices and how the polypeptide chain weaves through the membrane.
There are six extracellular protein regions, the number of cytoplasmic protein regions is actually seven due to the presence of a cytoplasmic C-terminal tail after the final transmembrane domain.
The passage indicates that Glut5 consists of twelve transmembrane α-helices. Since the N-terminus of Glut5 is located inside the cytoplasm, and the helices alternate between crossing into the extracellular and cytoplasmic spaces, every even-numbered helix (2, 4, 6, 8, 10, 12) is followed by a cytoplasmic region. Additionally, after helix 12, the C-terminal tail of the protein is also cytoplasmic, contributing to a total of seven cytoplasmic regions.
This choice misinterprets the structure of Glut5. While there are 12 transmembrane α-helices, only seven cytoplasmic protein regions are present.
There are thirteen protein regions that are not transmembrane α-helices. This option assumes that all non-transmembrane regions are cytoplasmic. However, Glut5 also has extracellular loops, which means only seven of the non-transmembrane regions are cytoplasmic.

This question asks about the type of control researchers used during the immunohistochemistry experiment. To answer this question, we must understand the principles of experimental controls, immunohistochemistry, and protein expression patterns. A negative control is a sample that is not expected to show a response, helping to confirm that any observed effects in experimental samples are specific. A positive control is a sample that is expected to show a known response, ensuring that the experiment is working correctly.

Immunohistochemistry is a technique used to detect specific antigens in intact tissue sections using antibodies. The level of staining (or signal) corresponds to the presence of the target protein in the tissue. According to the passage, Glut5 is typically expressed in the intestinal epithelium but not in normal pancreatic tissue. However, PDAC-affected tissue shows higher Glut5 levels. This suggests that normal (unaffected) pancreatic tissue should have low or no Glut5 expression, making it a negative control for the experiment.

A positive control is a sample that is expected to show high levels of the target antigen to confirm that the experimental method is working correctly. Since unaffected pancreatic tissue has low Glut5 expression, it does not serve as a positive control. Instead, a tissue known to naturally express high levels of Glut5, such as intestinal epithelium, would have been a better positive control.
Since immunohistochemistry is used to assess the presence of antigens in intact tissue slices, a negative control should have low Glut5 levels. Glut5 is a fructose transporter associated with cancer and high fructose levels have been associated with the development of cancer. Because Glut5 is not typically expressed in the pancreas, unaffected pancreatic tissue serves as the negative control. This ensures that any observed Glut5 expression in PDAC-affected tissue is due to the disease rather than normal physiological expression.
Researchers used unaffected pancreatic tissue as a control. Since Glut5 is a fructose transporter and high fructose consumption is linked to cancer, the unaffected tissue would be expected to have low rather than high Glut5 levels.
A negative control is expected to have low expression of the target protein, not high. The unaffected pancreatic tissue serves as a negative control because it has low Glut5 expression. If the unaffected pancreatic tissue had high Glut5 levels, it would not be an appropriate negative control.

This question asks about the effect of fructose on PDAC cell proliferation. To answer this question, we must understand the principles of cancer cell metabolism, glucose and fructose transport, and experimental controls. Cancer cell metabolism is often altered to favor rapid proliferation, relying on increased nutrient uptake and specific metabolic pathways. In this experiment, researchers investigated how fructose affects PDAC cell proliferation and whether Glut5 expression plays a role in this process.

Fructose and glucose enter cells through different transporters. Glut5 is a specialized fructose transporter, while glucose transporters such as Glut1 facilitate glucose uptake. To determine whether fructose-driven PDAC proliferation depends on Glut5 expression, researchers used an empty vector (control) and a Glut5-overexpressing vector. This allowed them to assess whether the presence of Glut5 enhances fructose-mediated cell proliferation.

The figure indicates that fructose increases PDAC cell proliferation in both conditions: when cells are transfected with an empty vector and when Glut5 is overexpressed. If fructose only promoted growth in cells with an empty vector, we would expect no increase in cell count in the Glut5-overexpressing condition, which is not the case.
Fructose does not exclusively increase PDAC cell proliferation in Glut5-overexpressing cells. The data show that PDAC cells transfected with an empty vector also exhibit increased proliferation when exposed to fructose, though to a lesser extent compared to Glut5-overexpressing cells.
Figure 1 shows that fructose increases PDAC cell proliferation in both conditions—whether transfected with an empty vector or a Glut5-expressing vector. However, the proliferation rate reaches the same level as that observed in glucose-containing medium only when Glut5 is overexpressed. This suggests that while fructose promotes PDAC cell proliferation regardless of Glut5 expression, its full effect—matching glucose-induced proliferation—depends on Glut5 overexpression, confirming option C as the correct answer.
PDAC cells cultured in fructose-containing medium only exhibit the same growth rate as those cultured in glucose-containing medium transfected with a Glut5-expressing vector. If fructose promoted proliferation to the same extent as glucose in all conditions, then even cells transfected with an empty vector would show identical growth rates in fructose and glucose conditions, which is not what the figure indicates.

This question asks about the difference that is most likely observed in PDAC cells cultured in a fructose-containing medium. To answer this question, we must understand the principles of cellular metabolism, signaling pathways, and autophagy regulation.

Fructose metabolism differs from glucose metabolism and can impact regulatory pathways within the cell. Fructose uptake via Glut5 can influence energy balance and metabolic signaling. The passage states that in PDAC cells, fructose intake has been shown to decrease AMPK (AMP-activated protein kinase) activity. Since AMPK is an inhibitor of mTORC1 (mechanistic target of rapamycin complex 1), this will lead to increased mTORC1 activity.

mTORC1 is a regulator of cell growth and metabolism and is known to suppress autophagy by inhibiting ULK1 (Unc-51 Like Autophagy Activating Kinase 1), a protein necessary for initiating autophagy. As fructose decreases AMPK activity, mTORC1 becomes more active, leading to ULK1 inhibition. As ULK1 induces autophagy, decreased ULK1 activity will lead to decreased autophagy. Since autophagy is a process where cells degrade and recycle damaged organelles and macromolecules using lysosomal function, a decrease in autophagy directly results in decreased lysosomal activity.

In PDAC cells, exposure to a fructose-containing medium leads to a reduction in AMPK activity. Since AMPK normally acts to suppress mTORC1, its decreased activity results in heightened mTORC1 signaling. mTORC1, in turn, suppresses ULK1 activity, meaning PDAC cells cultured in a fructose-rich environment will exhibit lower ULK1 activity than those grown in a sugar-free medium.
Thus, PDAC cells cultured in a fructose-containing medium are expected to exhibit increased mTORC1 activity, decreased ULK1 activity, suppressed autophagy, and ultimately reduced lysosomal activity compared to cells grown in a sugar-free medium.
PDAC cells exposed to fructose exhibit reduced AMPK activity. Since AMPK acts as an inhibitor of mTORC1, its lower activity means that mTORC1 signaling becomes more pronounced in a fructose-containing medium.
Researchers found that AMPK activation was lower in PDAC cells cultured in a fructose-containing medium. Since AMPK functions as a kinase responsible for phosphorylating mTORC1, a decrease in AMPK activity leads to diminished mTORC1 phosphorylation. However, due to the reduced inhibitory effect of AMPK on mTORC1, mTORC1 remains more active.

This question asks about the number of nucleotides that encode STMP1. To answer this question, we must understand the principles of the genetic code. Each amino acid in a protein is encoded by a codon, which consists of three nucleotides.
This is the number of amino acids that compose STMP1. In addition, this option assumes that each amino acid is encoded by a single nucleotide, which is not the case. Instead, each amino acid requires a triplet codon of three nucleotides.
This option suggests that each amino acid is encoded by two nucleotides, which contradicts the well-established genetic code where each codon consists of three nucleotides.
Since the passage indicates that STMP1 is composed of 47 amino acids, the total number of nucleotides in the coding sequence can be calculated as 47 amino acids × 3 nucleotides per codon = 141 nucleotides. This accounts for the entire open reading frame (ORF) of STMP1.
This option likely refers to the total number of bases in the double-stranded DNA sequence of the STMP1 gene, but the actual coding region (ORF) required to produce the protein is 141 nucleotides.

This question asks about the number of hydrogen bonds that connect the primer shown in the passage with its complementary strand. To determine the number of hydrogen bonds that connect the primer sequence with its complementary strand, we need to analyze the base-pairing rules. Adenine (A) pairs with thymine (T) via two hydrogen bonds, while cytosine (C) pairs with guanine (G) via three hydrogen bonds.
The primer is composed of 10 (A+T) and 11 (C+G). Therefore, it will form 20 + 33 = 53, rather than 38, hydrogen bonds. This option underestimates the number of hydrogen bonds and might result from miscounting the number of C-G pairs.
Since the primer in the passage consists of 10 (A+T) nucleotides and 11 (C+G) nucleotides, a total of 53 hydrogen bonds, rather than 43, will connect the two strands.
Because T and A nucleotides form two hydrogen bonds each, and C and G nucleotides form three hydrogen bonds each, the primer will bind to its complementary strand with a total of 53 hydrogen bonds instead of 48.
The given primer sequence is 5′–ATGCTCCAGTTCCTGCTTGGA–3′. We count the number of each nucleotide in this primer: Adenine (A) = 5, Thymine (T) = 5, Cytosine (C) = 6, and Guanine (G) = 5. Since A-T pairs form two hydrogen bonds each and C-G pairs form three hydrogen bonds each, we can calculate the total number of hydrogen bonds as follows: A-T hydrogen bonds: 10 × 2 = 20, C-G hydrogen bonds: 11 × 3 = 33. Adding these together: 20 + 33 = 53.

This question asks about the enzyme that is most likely upregulated within the heart tissue of STMP1-KO mice compared to WT litter mates. To understand this question, we must understand the principles of cellular metabolism, particularly how cells generate ATP under normal and stressed conditions.

Cells generate ATP primarily through aerobic respiration, which includes glycolysis, the citric acid cycle, and oxidative phosphorylation in the electron transport chain (ETC). The ETC, located in the inner mitochondrial membrane, relies on a series of protein complexes (I-IV) to transfer electrons, ultimately driving ATP synthesis via ATP synthase (Complex V). Cytochrome c reductase (Complex III) is an important enzyme in the ETC, helping shuttle electrons from ubiquinol (QH2) to cytochrome c.

If the ETC is impaired, as seen in STMP1-KO mice, cells cannot efficiently produce ATP through oxidative phosphorylation. To compensate, they shift toward anaerobic glycolysis, where lactate dehydrogenase (LDH) plays a role in regenerating NAD+, allowing glycolysis to continue producing ATP in the absence of ETC function.

Experiment 2 shows that STMP1-KO mice have reduced cytochrome c reductase activity, leading to a compromised ETC and impaired ATP production. This metabolic deficiency forces cardiac cells to increase reliance on anaerobic glycolysis. However, glycolysis produces NADH, which must be recycled to NAD+ to sustain ATP production. LDH catalyzes the conversion of pyruvate to lactate, a reaction that regenerates NAD+. This enables glycolysis to continue in low oxygen (hypoxic) or ETC-deficient conditions. Therefore, in STMP1-KO mice, LDH activity is likely upregulated as a compensatory response to maintain ATP production.

The STMP1-KO mice display an impaired electron transport chain (ETC), which in turn leads to a reduction in oxidative phosphorylation. The decreased activity of complex III disrupts the flow of electrons through the ETC and diminishes proton pumping. As a result, the formation of a proton gradient is compromised, slowing down the function of the ATP synthase enzyme.
This enzyme is specific to the liver and plays a role in gluconeogenesis. However, since the focus of the passage is on the function of STMP1 in cardiac tissue, only cardiac-related enzymes should be considered. Therefore, this option is not relevant.
Given that the STMP1-KO mice have a dysfunctional ETC, the availability of substrates for this pathway would be restricted. Instead, the conversion of pyruvate to lactate by lactate dehydrogenase facilitates the regeneration of NAD+ from NADH, which is reduced during glycolysis. This process ensures that glycolysis can continue, producing ATP via substrate-level phosphorylation independently of the ETC and oxidative phosphorylation. Consequently, it is reasonable to infer that the activity of lactate dehydrogenase would be increased in STMP1-KO animals.
Since STMP1-KO mice experience impaired ETC function and aerobic respiration due to decreased complex III activity, pyruvate dehydrogenase, which links glycolysis to the citric acid cycle by converting pyruvate into acetyl-CoA, is likely to have reduced activity rather than being upregulated.

This question asks about the structures that are exclusive to the tissue that is enriched with STMP1. To answer this question, we must understand the principles of histology and cellular junctions in muscle tissue.
Transverse tubules are present in both cardiac and skeletal muscle cells. These invaginations of the sarcolemma help propagate action potentials deep into the muscle fibers to trigger contraction, but they are not exclusive to cardiac tissue. Since transverse tubules also exist in skeletal muscle, they do not meet the requirement of being unique to STMP1-enriched tissue.
Intercalated discs are unique to cardiac muscle tissue and facilitate action potentials and electrical connectivity between cardiac muscle cells. These specialized junctions consist of three major components: desmosomes, gap junctions, and fascia adherens, which work together to enable the synchronized contraction of the heart. Intercalated discs are essential for maintaining the structural integrity of cardiac muscle and ensuring efficient signal transmission for coordinated heartbeats. Since STMP1 is highly enriched in cardiac tissues, the exclusive structures associated with it must also be specific to cardiac muscle, making intercalated discs the correct choice.
Gap junctions are intercellular channels that facilitate the direct exchange of ions and small molecules between adjacent cells, promoting cell-to-cell communication. While they are an essential component of intercalated discs in cardiac muscle, they are not exclusive to cardiac tissue. Gap junctions are found in other tissues, such as smooth muscle and certain epithelial tissues.
Desmosomes are strong adhesive intercellular junctions that provide mechanical stability by linking the cytoskeletons of adjacent cells. Although they are a part of intercalated discs in cardiac tissue, desmosomes are also present in other tissues, such as the skin and epithelial layers, where they help resist mechanical stress.

This question asks about the explanation that best accounts for STMP1-HA resistance to protease digestion in Experiment 1. To answer this question, we must understand the principles of protein localization and protease accessibility. In Experiment 1, researchers used protease digestion to investigate the subcellular localization of STMP1-HA. The main observation was that STMP1-HA, like ATP synthase, was resistant to proteolytic degradation, whereas TOMM20 was not. This suggests that STMP1-HA is localized in a mitochondrial compartment where the protease cannot access it.
STMP1-HA’s resistance to protease digestion indicates that it is likely located within the inner mitochondrial membrane or matrix, similar to ATP synthase, where the protease cannot reach it. In contrast, TOMM20, which resides in the outer mitochondrial membrane, was degraded, demonstrating that the protease could access proteins in this compartment. This suggests that STMP1-HA is protected from proteolysis due to its subcellular localization, not due to the properties of the protease itself.
The protease is not specific for STMP1 digestion. This is incorrect because the experiment used a peptide-independent protease, which means it cleaves proteins based on common peptide bonds rather than specific sequences. If STMP1 were accessible to the protease, it would have been degraded. The fact that STMP1 was resistant suggests an accessibility issue rather than enyzme specificity issue. Experiment 1 provides insight into protein localization and does not address enzyme specificity.
Hydrolysis of peptide bonds is an exergonic process, meaning it releases energy rather than requiring ATP input. Proteases do not need ATP to cleave peptide bonds, so the availability of ATP does not affect protease function in this experiment.
Proteases cleave peptide bonds irrespective of protein size. Even small proteins are subject to proteolytic degradation as long as they are accessible to the enzyme. The fact that STMP1 was not degraded suggests that it was protected due to its localization, not its size.

This question asks about the location within the mitochondria where STMP1 is most likely localized. To understand this question, we must understand the principles of mitochondrial structure and protein localization. The mitochondrion consists of four main compartments: the outer membrane, the intermembrane space, the inner membrane, and the matrix. The inner membrane contains some proteins involved in oxidative phosphorylation, such as ATP synthase and cytochrome c reductase, which are essential for mitochondrial function.
Two pieces of evidence suggest that STMP1-HA is not found in the mitochondrial matrix. First, the passage states that STMP1-HA co-localizes with ATP synthase, and second, it is directly associated with cytochrome c reductase. Since both of these proteins are located on the inner mitochondrial membrane, STMP1-HA is likely situated there as well.
According to the passage, STMP1-HA is found alongside ATP synthase and cytochrome c reductase, both of which are located on the mitochondrial inner membrane rather than the outer membrane.
The passage indicates some information which help us to conclude the correct answer. First, the experiment revealed that STMP1-HA co-localizes with ATP synthase, a well-known protein of the inner mitochondrial membrane. Second, STMP1 was shown to be directly associated with cytochrome c reductase, another enzyme that resides in the inner membrane. Since STMP1 exhibits the same protease resistance pattern as ATP synthase, it strongly suggests that STMP1 is located in the inner membrane.
The experimental results show that STMP1-HA is co-localized with two proteins found on the mitochondrial inner membrane rather than in the intermembrane space.

This question asks about the heart chamber which directly connects to the blood vessel that is affected by TAC. To understand this question, we must understand the principles of cardiac anatomy and circulation. The heart is divided into four chambers: the left atrium, left ventricle, right atrium, and right ventricle. Blood flows in a specific pathway through the heart to ensure proper oxygenation and circulation. The left ventricle is responsible for pumping oxygenated blood into the aorta, the largest artery in the body, which then distributes blood to the systemic circulation.
TAC affects the aorta, a blood vessel that connects directly to the left ventricle rather than the left atrium of the heart.
Transverse aortic constriction (TAC) is a surgical procedure that induces pressure overload by constricting the aorta, mimicking conditions such as hypertension or aortic stenosis. Since the aorta is directly connected to the left ventricle, this chamber is most affected by TAC.
It is the left ventricle and not the right atrium of the heart that pumps blood directly into the aorta to deliver oxygenated blood to the body. The right atrium receives deoxygenated blood from the systemic circulation via the superior and inferior vena cava and pumps it into the right ventricle. It is not connected to the aorta and does not play a role in systemic blood distribution.
Based on the passage, TAC affects the aorta, an artery that is connected to the left ventricle, rather than the right ventricle, and delivers oxygenated blood to the body. The right ventricle pumps deoxygenated blood into the pulmonary arteries leading to the lungs for oxygenation. The right ventricle is not directly affected by aortic constriction, as it is responsible for pulmonary circulation rather than systemic circulation.

This question asks about the two enzymes that are used in an RT-PCR reaction. To answer this question, we must understand the principles of reverse transcription and polymerase chain reaction (PCR).
DNase is not an essential enzyme in RT-PCR. DNase is sometimes used before RT-PCR to remove any contaminating DNA from an RNA sample, but it is not one of the two core enzymes involved in the reaction. This step is then followed by reverse transcription of RNA molecules. Additionally, RNA polymerase is not used in RT-PCR, as its function is to synthesize RNA from a DNA template, which is not needed in this process.
DNA polymerase is used in RT-PCR, but RNase is not. RNase is an enzyme that degrades RNA molecules, which would be counterproductive in RT-PCR, as the goal is to convert RNA into cDNA for amplification.
RNA polymerase is not involved in RT-PCR. RNA polymerase transcribes RNA from a DNA template, which occurs in gene expression but not in RT-PCR. Instead, reverse transcriptase is required to convert RNA into cDNA before amplification.
Reverse Transcription (RT) is the process of synthesizing complementary DNA (cDNA) from an RNA template, catalyzed by reverse transcriptase, an enzyme commonly derived from retroviruses. This enzyme is essential for RT-PCR, as it allows RNA to be converted into cDNA for further analysis. Once cDNA is generated, the Polymerase Chain Reaction (PCR) is used to amplify the cDNA through cycles of denaturation, annealing, and extension, requiring the enzyme DNA polymerase. This enzyme synthesizes new DNA strands by adding nucleotides to a primer, enabling the amplification of the cDNA for detection and quantification. RT-PCR is a widely used technique for studying gene expression by converting RNA into cDNA before amplification.

This question asks about how histone acetylation affects access to genomic DNA. To answer this question, we must understand the role of histone acetylation in chromatin remodeling and gene expression regulation. DNA is tightly wound around histone proteins to form nucleosomes, which help compact genetic material into chromatin. The interaction between histones and DNA is influenced by the positive charge of lysine residues on histone tails, which interact with the negatively charged phosphate backbone of DNA, promoting a tightly packed chromatin structure known as heterochromatin, which is transcriptionally inactive. Histone acetylation, catalyzed by histone acetyltransferases (HATs), adds acetyl groups to lysine residues, neutralizing their positive charge.
This reduces the electrostatic attraction between histones and DNA, leading to a more relaxed chromatin state called euchromatin, which is more accessible to transcription factors and RNA polymerase, facilitating gene expression.
Histone acetylation neutralizes the positive charge of lysine residues, loosening chromatin structure and promoting euchromatin formation, which enhances access to genomic DNA rather than restricting it.
Acetylation occurs on lysine residues, not glutamate residues. Glutamate is negatively charged and is not involved in the same histone-DNA interactions as lysine.
This option falsely states that neutralizing a negative charge (such as on glutamate) would loosen DNA-histone interactions. In reality, it is the neutralization of lysine’s positive charge that reduces DNA-histone binding, allowing chromatin to open and increasing DNA accessibility. Additionally, neutralizing histones’ negative charges loosens DNA–histone interaction and therefore it increases, rather than decreases, access to genomic DNA.

This question asks about the charge of a 25-residue synthetic peptide at physiological pH, assuming that the peptide is composed of only charged amino acids. To understand this question, we must understand the principles of amino acid charge states at physiological pH (approximately 7.4) and how the ratio of acidic to basic residues affects the net charge of a peptide. Amino acids with charged side chains include acidic residues (aspartic acid and glutamic acid), which carry a negative charge at physiological pH, and basic residues (lysine, arginine, and histidine), which carry a positive charge at physiological pH.
The problem states that the peptide consists only of charged amino acids and provides the ratio of acidic (negatively charged) to basic (positively charged) residues as 4:1. Let x represent the number of basic residues, meaning the number of acidic residues is 4x. Since the total number of residues is 25, we set up the equation:

x + 4x = 25, which simplifies to 5x = 25, solving for x = 5.

Thus, there are 5 basic residues and 20 acidic residues in the peptide. At physiological pH, the basic residues contribute a charge of +5, while the acidic residues contribute a charge of -20. The net charge is therefore -20 + 5 = -15.

This answer incorrectly assumes an acidic-to-basic residue ratio of 1.5 instead of 4.
This answer incorrectly assumes an acidic-to-basic residue ratio of 0.75 instead of 4.
This answer incorrectly assumes an acidic-to-basic residue ratio of 0.25 instead of 4.

To understand this question, we must understand the principles of enzyme inhibition and how a noncompetitive inhibitor affects the Lineweaver–Burk plot. The Lineweaver–Burk plot is a double reciprocal plot of enzyme kinetics, where 1/V (the inverse of reaction velocity) is plotted against 1/[S](the inverse of substrate concentration). The equation for this plot is derived from the Michaelis–Menten equation and is given by:

1/V = (Km/Vmax)(1/[S]) + 1/Vmax

where the slope is Km/Vmax, the y-intercept is 1/Vmax, and the x-intercept is −1/Km.

In the Lineweaver–Burk plot of enzyme kinetics, addition of a noncompetitive inhibitor increases the slope of the plot, does not affect the x-intercept, and shifts the y-intercept upward. A noncompetitive inhibitor binds to an allosteric site rather than the active site and does not compete with the substrate for binding. This means it reduces Vmax (the maximum reaction velocity) but does not change Km (the substrate concentration at which the reaction reaches half of Vmax).

When a noncompetitive inhibitor is added to an enzymatic reaction, it increases the slope of the Lineweaver–Burk plot rather than decreasing it, has no effect on the x-intercept, and causes the y-intercept to shift upward instead of downward.
The addition of a noncompetitive inhibitor to an enzymatic reaction leads to an increase in the slope of the Lineweaver–Burk plot and an upward shift of the y-intercept, rather than a downward shift.
This describes how a competitive inhibitor affects the Lineweaver–Burk plot. Competitive inhibitors increase Km, making the x-intercept shift toward zero (becoming less negative), but they do not affect Vmax, meaning the y-intercept stays the same. However, in noncompetitive inhibition, Km remains unchanged, the x-intercept does not change, and the y-intercept shifts upward.
Since 1/Vmax increases when Vmax decreases, the y-intercept shifts upward. The x-intercept remains unchanged because Km is unaffected. The slope increases because the slope is given by Km/Vmax, and a decrease in Vmax causes the slope to rise.